Incidental Mutation 'R1655:Zfp40'
ID189061
Institutional Source Beutler Lab
Gene Symbol Zfp40
Ensembl Gene ENSMUSG00000002617
Gene Namezinc finger protein 40
SynonymsNTfin12, Zfp-40
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1655 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23173869-23193252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23177266 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 48 (Y48N)
Ref Sequence ENSEMBL: ENSMUSP00000121359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037057] [ENSMUST00000140313] [ENSMUST00000172177]
Predicted Effect probably benign
Transcript: ENSMUST00000037057
AA Change: Y116N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039794
Gene: ENSMUSG00000002617
AA Change: Y116N

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135840
Predicted Effect probably benign
Transcript: ENSMUST00000140313
AA Change: Y48N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121359
Gene: ENSMUSG00000002617
AA Change: Y48N

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-16 BLAST
ZnF_C2H2 157 179 1.47e-3 SMART
ZnF_C2H2 213 234 5.77e0 SMART
ZnF_C2H2 240 262 4.34e0 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
ZnF_C2H2 295 317 4.24e-4 SMART
ZnF_C2H2 323 345 2.75e-3 SMART
ZnF_C2H2 351 373 1.38e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 8.47e-4 SMART
ZnF_C2H2 463 485 2.57e-3 SMART
ZnF_C2H2 491 513 8.47e-4 SMART
ZnF_C2H2 519 541 4.54e-4 SMART
ZnF_C2H2 547 568 1.26e1 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 3.21e-4 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
ZnF_C2H2 658 680 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142999
Predicted Effect probably benign
Transcript: ENSMUST00000172177
AA Change: Y116N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128758
Gene: ENSMUSG00000002617
AA Change: Y116N

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Zfp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Zfp40 APN 17 23175742 missense probably benign 0.18
IGL02664:Zfp40 APN 17 23176986 missense probably benign 0.14
IGL02729:Zfp40 APN 17 23178311 missense probably damaging 0.99
R1288:Zfp40 UTSW 17 23182162 missense probably benign 0.01
R1450:Zfp40 UTSW 17 23175258 missense probably benign 0.15
R1535:Zfp40 UTSW 17 23175869 missense probably damaging 1.00
R1797:Zfp40 UTSW 17 23175540 missense possibly damaging 0.93
R2254:Zfp40 UTSW 17 23178370 missense possibly damaging 0.92
R3764:Zfp40 UTSW 17 23177127 missense possibly damaging 0.49
R4356:Zfp40 UTSW 17 23177190 missense probably benign 0.15
R4402:Zfp40 UTSW 17 23176719 missense possibly damaging 0.49
R4781:Zfp40 UTSW 17 23175655 missense probably damaging 0.99
R4792:Zfp40 UTSW 17 23177034 missense possibly damaging 0.79
R6142:Zfp40 UTSW 17 23176337 missense probably benign 0.40
R6179:Zfp40 UTSW 17 23178380 missense possibly damaging 0.51
R6759:Zfp40 UTSW 17 23176536 missense possibly damaging 0.95
R7294:Zfp40 UTSW 17 23176437 missense possibly damaging 0.60
R7332:Zfp40 UTSW 17 23176181 nonsense probably null
R7386:Zfp40 UTSW 17 23177007 missense probably damaging 0.96
R7462:Zfp40 UTSW 17 23178388 missense possibly damaging 0.71
R7479:Zfp40 UTSW 17 23177318 missense probably benign 0.23
R7641:Zfp40 UTSW 17 23178283 missense possibly damaging 0.92
R7725:Zfp40 UTSW 17 23178277 missense probably benign 0.38
X0022:Zfp40 UTSW 17 23177154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ggtaaggtttttctccACTACACATTCGTT -3'
(R):5'- TTGCATTAGCTTTTGATCACCTGTTTGTTT -3'

Sequencing Primer
(F):5'- tttctccACTACACATTCGTTTTATC -3'
(R):5'- CTTTGAGAACTTAAACTTAAGGAGGC -3'
Posted On2014-05-09