Incidental Mutation 'R1656:Olfr339'
ID189069
Institutional Source Beutler Lab
Gene Symbol Olfr339
Ensembl Gene ENSMUSG00000094464
Gene Nameolfactory receptor 339
SynonymsMOR136-3, GA_x6K02T2NLDC-33116096-33117025
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36418947-36426123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36421646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 83 (V83M)
Ref Sequence ENSEMBL: ENSMUSP00000149068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071437] [ENSMUST00000216645]
Predicted Effect probably benign
Transcript: ENSMUST00000071437
AA Change: V83M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071383
Gene: ENSMUSG00000094464
AA Change: V83M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-55 PFAM
Pfam:7tm_1 41 290 5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216645
AA Change: V83M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Olfr339
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr339 APN 2 36421704 missense probably benign 0.44
IGL01447:Olfr339 APN 2 36421454 missense probably damaging 0.97
IGL01845:Olfr339 APN 2 36422093 missense probably benign 0.27
IGL02728:Olfr339 APN 2 36422144 missense possibly damaging 0.95
IGL02941:Olfr339 APN 2 36422120 missense probably damaging 1.00
R0128:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R0130:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R1432:Olfr339 UTSW 2 36421643 missense probably damaging 1.00
R1451:Olfr339 UTSW 2 36421865 missense probably benign 0.01
R1854:Olfr339 UTSW 2 36421874 missense probably damaging 0.97
R2012:Olfr339 UTSW 2 36421919 missense probably benign 0.00
R2093:Olfr339 UTSW 2 36421929 missense probably benign 0.00
R2136:Olfr339 UTSW 2 36421938 missense probably damaging 1.00
R2282:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R4363:Olfr339 UTSW 2 36421532 missense probably damaging 1.00
R4466:Olfr339 UTSW 2 36422296 missense probably benign 0.00
R4628:Olfr339 UTSW 2 36421857 nonsense probably null
R4839:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R6023:Olfr339 UTSW 2 36421511 missense probably damaging 0.98
R6305:Olfr339 UTSW 2 36421622 missense probably damaging 1.00
R6486:Olfr339 UTSW 2 36421544 missense probably damaging 1.00
R6851:Olfr339 UTSW 2 36421820 missense probably damaging 0.97
R6864:Olfr339 UTSW 2 36421820 missense probably damaging 0.97
R7771:Olfr339 UTSW 2 36422144 missense possibly damaging 0.95
R8165:Olfr339 UTSW 2 36421703 missense probably damaging 1.00
R8307:Olfr339 UTSW 2 36422321 missense probably benign 0.03
R8961:Olfr339 UTSW 2 36422165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACCTGACAACTGTGCTGGGG -3'
(R):5'- TCAGAATGGTGACACCAATGTAGCC -3'

Sequencing Primer
(F):5'- TGGGGAACCTGCTCATCATC -3'
(R):5'- TCTGAGCTAGACAGCTTCAGC -3'
Posted On2014-05-09