Incidental Mutation 'R1656:Wdfy3'
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101941447 bp
Amino Acid Change Isoleucine to Asparagine at position 627 (I627N)
Ref Sequence ENSEMBL: ENSMUSP00000134541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
Predicted Effect probably damaging
Transcript: ENSMUST00000053177
AA Change: I627N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: I627N

low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172512
Predicted Effect probably damaging
Transcript: ENSMUST00000174598
AA Change: I627N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: I627N

low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174698
AA Change: I627N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: I627N

Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212024
AA Change: I627N

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.3549 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
R8507:Wdfy3 UTSW 5 101872901 missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101851353 missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 101885198 missense probably benign
R8710:Wdfy3 UTSW 5 101882483 missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 101930085 missense probably benign 0.00
R8749:Wdfy3 UTSW 5 101882580 missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacccaaacacacaacttaaaac -3'
Posted On2014-05-09