Incidental Mutation 'R1656:Srrm3'
ID189092
Institutional Source Beutler Lab
Gene Symbol Srrm3
Ensembl Gene ENSMUSG00000039860
Gene Nameserine/arginine repetitive matrix 3
Synonyms2900083I11Rik, Srrm2l, SRm300-like
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135806890-135874772 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 135835038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013615] [ENSMUST00000013615] [ENSMUST00000126232] [ENSMUST00000126232] [ENSMUST00000126232] [ENSMUST00000126232] [ENSMUST00000144211] [ENSMUST00000144211]
Predicted Effect probably benign
Transcript: ENSMUST00000013615
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000013615
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144211
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144211
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175494
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Srrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Srrm3 APN 5 135835249 missense probably damaging 1.00
IGL02716:Srrm3 APN 5 135854433 splice site probably null
IGL03099:Srrm3 APN 5 135869298 splice site probably benign
P0047:Srrm3 UTSW 5 135852926 splice site probably null
R0688:Srrm3 UTSW 5 135869276 utr 3 prime probably benign
R0811:Srrm3 UTSW 5 135873282 unclassified probably benign
R0812:Srrm3 UTSW 5 135873282 unclassified probably benign
R1083:Srrm3 UTSW 5 135854409 missense probably damaging 0.99
R1161:Srrm3 UTSW 5 135854392 small deletion probably benign
R1694:Srrm3 UTSW 5 135873225 unclassified probably benign
R1803:Srrm3 UTSW 5 135857129 missense probably damaging 0.99
R2037:Srrm3 UTSW 5 135854377 missense probably damaging 1.00
R2436:Srrm3 UTSW 5 135835176 nonsense probably null
R3826:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R3829:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R4840:Srrm3 UTSW 5 135854595 missense possibly damaging 0.81
R6526:Srrm3 UTSW 5 135835234 missense probably damaging 1.00
R6843:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R7408:Srrm3 UTSW 5 135852206 missense probably benign 0.04
R7583:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R8096:Srrm3 UTSW 5 135869240 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAAGTGATGGTACTCGCCCCTCC -3'
(R):5'- TGCTGAACAGTTTGATCTCGCCC -3'

Sequencing Primer
(F):5'- TCCCTCTACAGCGTGAGAAC -3'
(R):5'- CGTTCGTGGTCCAGGATCTC -3'
Posted On2014-05-09