Incidental Mutation 'R1656:Olfr293'
ID189104
Institutional Source Beutler Lab
Gene Symbol Olfr293
Ensembl Gene ENSMUSG00000063394
Gene Nameolfactory receptor 293
SynonymsGA_x6K02T2NHDJ-9457744-9456734, MOR221-3
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86649061-86666045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86664123 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 154 (L154F)
Ref Sequence ENSEMBL: ENSMUSP00000149959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081474] [ENSMUST00000214401] [ENSMUST00000215280]
Predicted Effect probably benign
Transcript: ENSMUST00000081474
AA Change: L154F

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080193
Gene: ENSMUSG00000063394
AA Change: L154F

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.1e-45 PFAM
Pfam:7tm_1 45 295 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214401
AA Change: L154F

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215280
AA Change: L154F

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.3212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Olfr293
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02478:Olfr293 APN 7 86664136 missense probably damaging 0.97
IGL02659:Olfr293 APN 7 86664081 missense probably benign 0.06
IGL02730:Olfr293 APN 7 86664067 missense probably damaging 0.98
IGL02959:Olfr293 APN 7 86664529 missense probably damaging 0.98
R0045:Olfr293 UTSW 7 86664340 missense possibly damaging 0.90
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0152:Olfr293 UTSW 7 86664511 missense probably damaging 1.00
R0669:Olfr293 UTSW 7 86664336 missense possibly damaging 0.79
R0942:Olfr293 UTSW 7 86664106 missense probably damaging 0.98
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R2010:Olfr293 UTSW 7 86664603 missense probably benign
R2056:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2059:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2105:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R4166:Olfr293 UTSW 7 86664394 missense probably damaging 1.00
R4303:Olfr293 UTSW 7 86663955 missense probably benign 0.16
R4531:Olfr293 UTSW 7 86664271 missense probably benign 0.02
R4808:Olfr293 UTSW 7 86663938 missense probably benign 0.00
R5748:Olfr293 UTSW 7 86664085 missense possibly damaging 0.61
R5937:Olfr293 UTSW 7 86664476 missense probably benign 0.00
R6178:Olfr293 UTSW 7 86664611 missense probably benign 0.45
R6766:Olfr293 UTSW 7 86664085 missense probably damaging 0.98
R7315:Olfr293 UTSW 7 86664237 missense probably damaging 0.99
R7585:Olfr293 UTSW 7 86664672 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTCACTGTGCCCAATGCTTGTATC -3'
(R):5'- CTACCACTGAGACCAATGGCAGTC -3'

Sequencing Primer
(F):5'- GTGCCCAATGCTTGTATCAACTC -3'
(R):5'- CAGTCAGAAGAAGTAAGAGTTTGTTG -3'
Posted On2014-05-09