Incidental Mutation 'R1656:Ctsc'
ID189105
Institutional Source Beutler Lab
Gene Symbol Ctsc
Ensembl Gene ENSMUSG00000030560
Gene Namecathepsin C
SynonymsDPPI, dipeptidylpeptidase 1, DPP1
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location88278085-88310888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88281408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000147006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032779] [ENSMUST00000128791] [ENSMUST00000131108]
Predicted Effect probably benign
Transcript: ENSMUST00000032779
AA Change: V65A

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032779
Gene: ENSMUSG00000030560
AA Change: V65A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 1.5e-48 PFAM
Pept_C1 230 457 1.05e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128791
AA Change: V64A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119503
Gene: ENSMUSG00000030560
AA Change: V64A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 7.1e-62 PFAM
SCOP:d3gcb__ 144 254 4e-8 SMART
Blast:Pept_C1 229 254 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131108
AA Change: V65A

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181565
Meta Mutation Damage Score 0.2276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the dipeptidyl peptidase 1 light, heavy, and exclusion domain chains, which together comprise one subunit of the homotetrameric enzyme. This enzyme has amino dipeptidase activity and may play a role in the activation of granzymes during inflammation. Homozygous knockout mice for this gene exhibit impaired granzyme activation and enhanced survival in a sepsis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit cytotoxic lymphocytes with inactive granzymes A and B which are incapable of granule-mediated apoptosis. Mutant mast cells lack activated chymase activity. Homozygotes for other alleles display a scruffy coat with age and behavioral abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Ctsc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Ctsc APN 7 88302271 missense possibly damaging 0.78
IGL02709:Ctsc APN 7 88308139 missense probably damaging 0.99
IGL03103:Ctsc APN 7 88309805 missense probably benign
IGL03117:Ctsc APN 7 88309780 missense probably damaging 0.99
R0071:Ctsc UTSW 7 88308149 unclassified probably benign
R0334:Ctsc UTSW 7 88278342 missense possibly damaging 0.81
R0587:Ctsc UTSW 7 88297229 missense probably benign 0.35
R1006:Ctsc UTSW 7 88309829 missense probably damaging 1.00
R1401:Ctsc UTSW 7 88281498 missense probably damaging 1.00
R1472:Ctsc UTSW 7 88281462 missense possibly damaging 0.88
R1602:Ctsc UTSW 7 88278304 missense possibly damaging 0.77
R1650:Ctsc UTSW 7 88281426 nonsense probably null
R1808:Ctsc UTSW 7 88299542 missense possibly damaging 0.49
R3848:Ctsc UTSW 7 88309610 missense probably benign 0.01
R4154:Ctsc UTSW 7 88299547 missense probably benign 0.01
R4614:Ctsc UTSW 7 88278375 critical splice donor site probably null
R5313:Ctsc UTSW 7 88309553 missense probably damaging 1.00
R6863:Ctsc UTSW 7 88302278 nonsense probably null
R6949:Ctsc UTSW 7 88281458 missense probably damaging 1.00
R7220:Ctsc UTSW 7 88297153 missense probably damaging 1.00
R7244:Ctsc UTSW 7 88302222 missense probably benign
R7254:Ctsc UTSW 7 88309559 missense probably damaging 1.00
R7732:Ctsc UTSW 7 88297159 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTTCACAGACTTGCCAGGAGCC -3'
(R):5'- CTTGGTGTAAAAGGAGCACTCCCG -3'

Sequencing Primer
(F):5'- agaggtaaggggatggagg -3'
(R):5'- ACTCCCGAGGTTCCTAATCAGG -3'
Posted On2014-05-09