Incidental Mutation 'R1656:Adgrg1'
ID189113
Institutional Source Beutler Lab
Gene Symbol Adgrg1
Ensembl Gene ENSMUSG00000031785
Gene Nameadhesion G protein-coupled receptor G1
SynonymsCyt28, Gpr56
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1656 (G1)
Quality Score210
Status Validated
Chromosome8
Chromosomal Location94974751-95014217 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 95011810 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 644 (Q644*)
Ref Sequence ENSEMBL: ENSMUSP00000148644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000212660]
Predicted Effect probably null
Transcript: ENSMUST00000093271
AA Change: Q644*
SMART Domains Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785
AA Change: Q644*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 8.1e-32 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179619
AA Change: Q644*
SMART Domains Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785
AA Change: Q644*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 3.4e-31 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211911
Predicted Effect probably null
Transcript: ENSMUST00000212660
AA Change: Q644*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Adgrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Adgrg1 APN 8 95005243 missense probably damaging 1.00
IGL01138:Adgrg1 APN 8 95003457 missense probably damaging 1.00
IGL01806:Adgrg1 APN 8 95012931 missense probably damaging 1.00
IGL02229:Adgrg1 APN 8 95003511 missense probably damaging 1.00
IGL03109:Adgrg1 APN 8 95007676 unclassified probably benign
D4043:Adgrg1 UTSW 8 95005229 unclassified probably null
R0383:Adgrg1 UTSW 8 95011742 missense probably damaging 1.00
R1155:Adgrg1 UTSW 8 95006840 missense possibly damaging 0.92
R1944:Adgrg1 UTSW 8 95007300 missense probably damaging 0.99
R1952:Adgrg1 UTSW 8 95008491 critical splice donor site probably null
R2408:Adgrg1 UTSW 8 95003493 missense probably null 1.00
R3776:Adgrg1 UTSW 8 95009655 missense probably damaging 0.99
R3813:Adgrg1 UTSW 8 95011565 missense probably benign 0.34
R4254:Adgrg1 UTSW 8 95005902 unclassified probably null
R4255:Adgrg1 UTSW 8 95005902 unclassified probably null
R4951:Adgrg1 UTSW 8 95005246 missense probably damaging 1.00
R4997:Adgrg1 UTSW 8 95009520 missense probably damaging 1.00
R5152:Adgrg1 UTSW 8 95009745 missense probably damaging 1.00
R6122:Adgrg1 UTSW 8 95002501 missense probably benign 0.45
R6897:Adgrg1 UTSW 8 95002498 missense probably benign
R7446:Adgrg1 UTSW 8 95011784 missense probably damaging 1.00
R7736:Adgrg1 UTSW 8 95005337 missense probably benign
R7784:Adgrg1 UTSW 8 95012882 nonsense probably null
Z1177:Adgrg1 UTSW 8 95007630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTTCCTGTTCAACCTGGC -3'
(R):5'- GGACCGACACAGAAGTAAGTGCTC -3'

Sequencing Primer
(F):5'- TGTTCAACCTGGCTATGCTG -3'
(R):5'- AGTGCTCAGCAGAGGCTTG -3'
Posted On2014-05-09