Incidental Mutation 'R1656:Myo1e'
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70395934 bp
Amino Acid Change Isoleucine to Asparagine at position 1079 (I1079N)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: I1079N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: I1079N

MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Meta Mutation Damage Score 0.8282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 splice site probably null
R5414:Myo1e UTSW 9 70322358 splice site probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
R7962:Myo1e UTSW 9 70335219 missense possibly damaging 0.64
R8309:Myo1e UTSW 9 70346763 missense possibly damaging 0.90
R8510:Myo1e UTSW 9 70335265 missense probably damaging 1.00
R8513:Myo1e UTSW 9 70320088 missense probably damaging 1.00
R8694:Myo1e UTSW 9 70383890 missense probably benign
R8720:Myo1e UTSW 9 70297288 missense possibly damaging 0.89
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gacaatgaactaaacctctgaacc -3'
Posted On2014-05-09