Incidental Mutation 'R1656:Cdk4'
ID189126
Institutional Source Beutler Lab
Gene Symbol Cdk4
Ensembl Gene ENSMUSG00000006728
Gene Namecyclin-dependent kinase 4
SynonymsCrk3, p34/cdk4
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127063534-127067920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127064980 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 167 (Y167C)
Ref Sequence ENSEMBL: ENSMUSP00000117234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably benign
Transcript: ENSMUST00000006911
AA Change: Y167C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: Y167C

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040307
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060991
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably benign
Transcript: ENSMUST00000125682
AA Change: Y167C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: Y167C

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133115
AA Change: Y167C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: Y167C

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Cdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Cdk4 APN 10 127064297 missense probably damaging 1.00
IGL01326:Cdk4 APN 10 127064623 missense possibly damaging 0.95
R0140:Cdk4 UTSW 10 127064345 missense probably damaging 1.00
R0799:Cdk4 UTSW 10 127064994 missense probably damaging 0.98
R1437:Cdk4 UTSW 10 127064689 missense probably damaging 1.00
R1575:Cdk4 UTSW 10 127064651 missense probably damaging 1.00
R1761:Cdk4 UTSW 10 127064677 unclassified probably benign
R2567:Cdk4 UTSW 10 127064276 missense probably benign 0.01
R4679:Cdk4 UTSW 10 127064911 missense possibly damaging 0.93
R4790:Cdk4 UTSW 10 127064701 missense probably damaging 1.00
R4897:Cdk4 UTSW 10 127064575 intron probably benign
R4946:Cdk4 UTSW 10 127064890 splice site probably null
R5755:Cdk4 UTSW 10 127064722 critical splice donor site probably null
R6515:Cdk4 UTSW 10 127066183 missense probably null 0.06
R6868:Cdk4 UTSW 10 127065001 missense probably benign 0.43
R7488:Cdk4 UTSW 10 127064237 start codon destroyed probably null 0.26
R7748:Cdk4 UTSW 10 127064429 missense possibly damaging 0.78
R8956:Cdk4 UTSW 10 127064677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGGACATACCTGGACAAAGCAC -3'
(R):5'- GTACCAGAGCGTAACCACCTGAAG -3'

Sequencing Primer
(F):5'- CTGCCGGTTGAGACCATTAAG -3'
(R):5'- CGTAACCACCTGAAGAGAATAGTAG -3'
Posted On2014-05-09