Incidental Mutation 'R1656:Cdh18'
ID189136
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23474399 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 785 (E785G)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: E785G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: E785G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165614
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226693
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R7927:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7953:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAGCTCACTCCGAGACATCAGAC -3'
(R):5'- GGGCACTTGTTTCTACAGGAGCTG -3'

Sequencing Primer
(F):5'- TGTCCACCCTGGAGAGCATAG -3'
(R):5'- GTGTACAGCTTGCTCAGTTC -3'
Posted On2014-05-09