Incidental Mutation 'R1656:Phf1'
ID189143
Institutional Source Beutler Lab
Gene Symbol Phf1
Ensembl Gene ENSMUSG00000024193
Gene NamePHD finger protein 1
SynonymsTctex3, Tctex-3, D17Ertd455e, mPcl1, PHF2
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26933127-26937890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26937359 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 492 (S492P)
Ref Sequence ENSEMBL: ENSMUSP00000073402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000078961] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000229490]
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073724
AA Change: S492P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193
AA Change: S492P

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078961
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184739
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Meta Mutation Damage Score 0.0734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the polycomb-like protein family, which is a component of polycomb repressive complex-2. This complex represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 and is required for the regulation of developmental genes including homeotic genes. The gene is expressed primarily in testis tissue. Small interfering RNA-mediated knockdown in cultured cell lines results in changes in homeotic gene expression coincident with alterations in promoter methylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Phf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Phf1 APN 17 26936594 missense possibly damaging 0.90
IGL01629:Phf1 APN 17 26934273 missense probably benign 0.07
IGL01931:Phf1 APN 17 26935535 unclassified probably benign
IGL02008:Phf1 APN 17 26935286 missense possibly damaging 0.95
IGL02048:Phf1 APN 17 26934541 unclassified probably benign
IGL02206:Phf1 APN 17 26936869 unclassified probably benign
IGL02252:Phf1 APN 17 26935135 missense possibly damaging 0.65
IGL02548:Phf1 APN 17 26935626 missense probably damaging 1.00
IGL03145:Phf1 APN 17 26934370 critical splice donor site probably null
R0539:Phf1 UTSW 17 26934458 splice site probably null
R0815:Phf1 UTSW 17 26937140 unclassified probably benign
R0863:Phf1 UTSW 17 26937140 unclassified probably benign
R1028:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R1083:Phf1 UTSW 17 26937270 unclassified probably benign
R1537:Phf1 UTSW 17 26935398 critical splice donor site probably null
R1587:Phf1 UTSW 17 26937492 missense probably damaging 0.99
R1956:Phf1 UTSW 17 26935745 splice site probably null
R2566:Phf1 UTSW 17 26937088 missense probably damaging 1.00
R3196:Phf1 UTSW 17 26934455 missense probably damaging 1.00
R4223:Phf1 UTSW 17 26937500 nonsense probably null
R4835:Phf1 UTSW 17 26934678 missense probably benign
R6439:Phf1 UTSW 17 26936612 missense probably benign
R7070:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R7289:Phf1 UTSW 17 26935315 missense probably damaging 1.00
R7846:Phf1 UTSW 17 26935317 nonsense probably null
R8165:Phf1 UTSW 17 26937070 missense possibly damaging 0.95
X0028:Phf1 UTSW 17 26936188 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAAGCCCAGACTAGCATCAGTCC -3'
(R):5'- GCATGAAAGTGCCAGTGTGTGAATG -3'

Sequencing Primer
(F):5'- GACTAGCATCAGTCCTGCCC -3'
(R):5'- AGGCTGTCAGAAGATGCCC -3'
Posted On2014-05-09