Incidental Mutation 'R0138:Sacm1l'
Institutional Source Beutler Lab
Gene Symbol Sacm1l
Ensembl Gene ENSMUSG00000025240
Gene NameSAC1 suppressor of actin mutations 1-like (yeast)
SynonymsSAC1, Sac1p
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location123529759-123592600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123548917 bp
Amino Acid Change Histidine to Glutamine at position 87 (H87Q)
Ref Sequence ENSEMBL: ENSMUSP00000026270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000217045]
AlphaFold Q9EP69
Predicted Effect probably benign
Transcript: ENSMUST00000026270
AA Change: H87Q

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240
AA Change: H87Q

Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217045
Meta Mutation Damage Score 0.4330 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Sacm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Sacm1l APN 9 123570549 missense possibly damaging 0.88
IGL02598:Sacm1l APN 9 123578996 missense probably benign 0.03
IGL02796:Sacm1l UTSW 9 123548924 missense possibly damaging 0.66
R0628:Sacm1l UTSW 9 123548995 splice site probably benign
R0847:Sacm1l UTSW 9 123548862 missense probably damaging 1.00
R1102:Sacm1l UTSW 9 123582298 missense probably damaging 0.98
R1159:Sacm1l UTSW 9 123566411 missense probably benign 0.06
R2898:Sacm1l UTSW 9 123560601 critical splice donor site probably null
R3001:Sacm1l UTSW 9 123585084 splice site probably benign
R3780:Sacm1l UTSW 9 123552790 missense probably benign 0.00
R3852:Sacm1l UTSW 9 123587576 missense probably damaging 1.00
R4731:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4732:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4733:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4894:Sacm1l UTSW 9 123582344 missense probably benign 0.17
R5021:Sacm1l UTSW 9 123582328 missense probably damaging 1.00
R5033:Sacm1l UTSW 9 123586399 missense probably damaging 1.00
R5075:Sacm1l UTSW 9 123582262 missense probably benign 0.00
R5135:Sacm1l UTSW 9 123577025 missense probably benign 0.00
R5284:Sacm1l UTSW 9 123586420 missense probably damaging 0.99
R5514:Sacm1l UTSW 9 123586354 nonsense probably null
R5629:Sacm1l UTSW 9 123566399 missense probably benign
R6137:Sacm1l UTSW 9 123569005 missense probably damaging 1.00
R6266:Sacm1l UTSW 9 123542420 missense probably damaging 1.00
R7079:Sacm1l UTSW 9 123569997 missense probably damaging 1.00
R7147:Sacm1l UTSW 9 123568951 missense probably damaging 1.00
R8205:Sacm1l UTSW 9 123586659 splice site probably null
R8323:Sacm1l UTSW 9 123548922 missense probably benign 0.22
R8544:Sacm1l UTSW 9 123577058 critical splice donor site probably null
R8801:Sacm1l UTSW 9 123582319 missense probably damaging 1.00
R9131:Sacm1l UTSW 9 123552762 nonsense probably null
Z1177:Sacm1l UTSW 9 123577028 missense possibly damaging 0.58
Predicted Primers PCR Primer
(R):5'- tctccggtcccTTAAAGAGTATCTCCA -3'

Sequencing Primer
(F):5'- ttttgtgatatgctagggctcaaac -3'
Posted On2014-05-13