Mutagenetix > Incidental Mutation

Incidental Mutation 'R0026:Nfkb1'

189162

Institutional Source

Beutler Lab

Gene Symbol

Nfkb1

Ensembl Gene

ENSMUSG00000028163

Gene Name

nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105

Synonyms

p50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1

MMRRC Submission

038321-MU

Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0026 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

135584655-135691547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135591573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 773 (D773G)

Ref Sequence

ENSEMBL: ENSMUSP00000128345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]

AlphaFold

P25799

PDB Structure

STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
STRUCTURE OF THE NUCLEAR FACTOR KAPPA-B (NF-KB) P50 HOMODIMER [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NF-kB(p50)2 COMPLEXED TO A HIGH-AFFINITY RNA APTAMER [X-RAY DIFFRACTION]
Crystal stucture of WLAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of MLAV mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of ILAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
>> 7 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000029812
AA Change: D773G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: D773G

Domain	Start	End	E-Value	Type
Pfam:RHD	42	240	2.9e-75	PFAM
IPT	247	348	1.14e-22	SMART
low complexity region	368	414	N/A	INTRINSIC
ANK	538	568	2.27e1	SMART
ANK	577	606	1.11e-2	SMART
ANK	610	640	2.47e0	SMART
ANK	646	675	5.53e-3	SMART
ANK	680	710	1.9e-1	SMART
ANK	714	743	2.18e-1	SMART
DEATH	801	888	1.9e-19	SMART
low complexity region	890	902	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129428

Predicted Effect

unknown
Transcript: ENSMUST00000132668
AA Change: D412G

SMART Domains

Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163
AA Change: D412G

Domain	Start	End	E-Value	Type
low complexity region	8	54	N/A	INTRINSIC
Blast:IPT	55	156	4e-22	BLAST
ANK	178	208	2.27e1	SMART
ANK	217	246	1.11e-2	SMART
ANK	250	280	2.47e0	SMART
ANK	286	315	5.53e-3	SMART
ANK	320	350	1.9e-1	SMART
ANK	354	383	2.18e-1	SMART
Blast:DEATH	441	505	1e-34	BLAST
PDB:2DBF\|A	442	505	5e-32	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150007

Predicted Effect

probably damaging
Transcript: ENSMUST00000164430
AA Change: D773G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: D773G

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	42	240	2.9e-75	PFAM
IPT	247	348	1.14e-22	SMART
low complexity region	368	414	N/A	INTRINSIC
ANK	538	568	2.27e1	SMART
ANK	577	606	1.11e-2	SMART
ANK	610	640	2.47e0	SMART
ANK	646	675	5.53e-3	SMART
ANK	680	710	1.9e-1	SMART
ANK	714	743	2.18e-1	SMART
DEATH	801	888	1.9e-19	SMART
low complexity region	890	902	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000184550
AA Change: D261G

Predicted Effect

probably benign
Transcript: ENSMUST00000196469

SMART Domains

Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	42	90	2.5e-19	PFAM

Meta Mutation Damage Score

0.2611

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

93% (70/75)

MGI Phenotype

Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]

Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,066,805	I585N	possibly damaging	Het
4931408C20Rik	T	A	1: 26,683,369	D910V	probably benign	Het
A830005F24Rik	C	T	13: 48,514,372		probably benign	Het
Abca16	C	T	7: 120,477,923		probably benign	Het
Acot10	G	A	15: 20,666,236	L140F	probably benign	Het
Adam19	G	T	11: 46,136,259	C573F	probably damaging	Het
Aff3	A	G	1: 38,203,893	S948P	probably benign	Het
Anxa3	T	A	5: 96,838,401	Y300N	probably benign	Het
BC016579	T	C	16: 45,640,367	T113A	probably benign	Het
Bmpr1b	A	G	3: 141,870,733	L113P	probably benign	Het
Casq1	T	C	1: 172,219,400		probably benign	Het
Cdc16	T	A	8: 13,759,130		probably null	Het
Cep135	C	T	5: 76,606,734	R353*	probably null	Het
Cma1	A	T	14: 55,942,164	C188S	probably damaging	Het
Csf3r	A	G	4: 126,031,884	T151A	probably benign	Het
Cyp4b1	C	T	4: 115,647,521	G56D	possibly damaging	Het
Dbn1	T	C	13: 55,477,784	E275G	probably damaging	Het
Dlgap2	C	T	8: 14,727,363	Q203*	probably null	Het
Ephb3	A	G	16: 21,214,917	D251G	probably damaging	Het
Fancd2os	G	T	6: 113,597,691	T118N	probably damaging	Het
Gm10801	T	C	2: 98,663,909		probably benign	Het
Got1l1	C	T	8: 27,200,248	V132I	probably benign	Het
H2-M9	T	C	17: 36,641,527		probably benign	Het
Ibtk	A	G	9: 85,690,303	V1278A	probably benign	Het
Kctd3	T	C	1: 188,976,621	T519A	probably damaging	Het
Lgsn	T	A	1: 31,203,443	V202D	probably damaging	Het
Madd	A	G	2: 91,175,708	F381L	possibly damaging	Het
Map1s	G	A	8: 70,914,638	G729D	probably damaging	Het
Mlycd	A	G	8: 119,410,435	I465V	probably benign	Het
Mrgprb1	T	C	7: 48,447,204	R108G	possibly damaging	Het
Mrgprx2	T	A	7: 48,482,023	H106L	possibly damaging	Het
Ncor1	T	C	11: 62,438,429	Y6C	probably damaging	Het
Nxnl1	A	G	8: 71,566,573	S3P	probably damaging	Het
Olfr109	T	A	17: 37,466,803	V199D	probably damaging	Het
Olfr921	G	A	9: 38,775,596	V114I	probably benign	Het
Otud7a	T	C	7: 63,735,801	F338L	probably benign	Het
Pdcl3	T	A	1: 38,991,280	L14Q	probably damaging	Het
Pla2g7	T	A	17: 43,594,930		probably benign	Het
Prpf31	T	A	7: 3,639,668	N413K	probably benign	Het
Rapgef5	T	C	12: 117,689,161	S307P	probably benign	Het
Relt	C	A	7: 100,850,221	E164*	probably null	Het
Rnf185	T	C	11: 3,426,617	D86G	probably damaging	Het
Rrm2b	T	C	15: 37,953,741	E21G	probably benign	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Senp1	T	C	15: 98,076,668	R88G	probably damaging	Het
Skint5	A	T	4: 113,546,468		probably benign	Het
Slc35b1	T	C	11: 95,390,642	S294P	probably benign	Het
Slc5a2	T	A	7: 128,270,053	I335N	probably damaging	Het
Sstr1	T	A	12: 58,212,858	M89K	probably damaging	Het
Szt2	A	T	4: 118,384,772	S1612R	possibly damaging	Het
Taf1c	T	C	8: 119,604,236		probably null	Het
Taf1d	T	A	9: 15,308,648	S64R	probably damaging	Het
Tmem125	A	G	4: 118,542,073	S54P	possibly damaging	Het
Ttf1	T	A	2: 29,071,349	I583N	possibly damaging	Het
Uchl4	A	T	9: 64,235,371		probably null	Het
Unc5b	A	T	10: 60,774,592	I482N	possibly damaging	Het
Unc80	C	A	1: 66,521,584	Q824K	probably benign	Het
Utrn	T	C	10: 12,726,196		probably benign	Het
Vmn2r61	T	G	7: 42,275,474	I484R	possibly damaging	Het
Vps13b	T	C	15: 35,923,301	I3774T	possibly damaging	Het
Yipf1	T	A	4: 107,345,160	L240*	probably null	Het

Other mutations in Nfkb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Nfkb1	APN	3	135590839	missense	probably damaging	1.00
IGL01345:Nfkb1	APN	3	135594981	missense	probably damaging	1.00
IGL01629:Nfkb1	APN	3	135601467	missense	probably benign
IGL02216:Nfkb1	APN	3	135594963	missense	probably damaging	0.98
IGL02273:Nfkb1	APN	3	135605207	missense	probably benign	0.01
IGL02508:Nfkb1	APN	3	135590818	missense	probably damaging	0.99
IGL03095:Nfkb1	APN	3	135618830	missense	possibly damaging	0.48
Conversely	UTSW	3	135626659	missense	probably damaging	1.00
Finlay	UTSW	3	135595053	nonsense	probably null
Frisbee	UTSW	3	135613943	missense	possibly damaging	0.93
Honeyeater	UTSW	3	135591551	splice site	probably benign
kookaburra	UTSW	3	135626611	nonsense	probably null
Murgatroyd	UTSW	3	135626710	missense	possibly damaging	0.72
Poderoso	UTSW	3	135613990	missense	probably damaging	1.00
Puff	UTSW	3	135595053	nonsense	probably null
Roomba	UTSW	3	135612412	critical splice donor site	probably null
Wheelo	UTSW	3	135615349	missense	possibly damaging	0.81
R0047:Nfkb1	UTSW	3	135595053	nonsense	probably null
R0989:Nfkb1	UTSW	3	135589396	missense	probably benign	0.00
R1210:Nfkb1	UTSW	3	135594927	missense	probably benign	0.03
R1661:Nfkb1	UTSW	3	135594957	missense	probably damaging	1.00
R1665:Nfkb1	UTSW	3	135594957	missense	probably damaging	1.00
R1725:Nfkb1	UTSW	3	135667758	missense	probably damaging	1.00
R1984:Nfkb1	UTSW	3	135615349	missense	possibly damaging	0.81
R1985:Nfkb1	UTSW	3	135615349	missense	possibly damaging	0.81
R2154:Nfkb1	UTSW	3	135601479	missense	probably benign	0.44
R2281:Nfkb1	UTSW	3	135601521	missense	probably damaging	1.00
R2409:Nfkb1	UTSW	3	135613943	missense	possibly damaging	0.93
R2504:Nfkb1	UTSW	3	135589329	missense	possibly damaging	0.51
R4032:Nfkb1	UTSW	3	135594349	missense	possibly damaging	0.63
R4232:Nfkb1	UTSW	3	135603770	missense	probably damaging	1.00
R4936:Nfkb1	UTSW	3	135613982	missense	probably damaging	0.97
R5085:Nfkb1	UTSW	3	135603807	missense	probably benign	0.36
R5262:Nfkb1	UTSW	3	135612412	critical splice donor site	probably null
R5384:Nfkb1	UTSW	3	135612542	missense	possibly damaging	0.95
R5385:Nfkb1	UTSW	3	135612542	missense	possibly damaging	0.95
R5434:Nfkb1	UTSW	3	135626611	nonsense	probably null
R5663:Nfkb1	UTSW	3	135603851	missense	possibly damaging	0.88
R5865:Nfkb1	UTSW	3	135603780	missense	probably damaging	1.00
R6006:Nfkb1	UTSW	3	135603761	nonsense	probably null
R6013:Nfkb1	UTSW	3	135626684	missense	possibly damaging	0.86
R6234:Nfkb1	UTSW	3	135626710	missense	possibly damaging	0.72
R6785:Nfkb1	UTSW	3	135615303	missense	probably benign
R7175:Nfkb1	UTSW	3	135613990	missense	probably damaging	1.00
R7227:Nfkb1	UTSW	3	135626659	missense	probably damaging	1.00
R7394:Nfkb1	UTSW	3	135613697	missense	possibly damaging	0.54
R7727:Nfkb1	UTSW	3	135585401	missense	possibly damaging	0.48
R7815:Nfkb1	UTSW	3	135603791	missense	probably damaging	1.00
R7849:Nfkb1	UTSW	3	135585412	missense
R8004:Nfkb1	UTSW	3	135591551	splice site	probably benign
R8059:Nfkb1	UTSW	3	135593852	missense	possibly damaging	0.54
R8806:Nfkb1	UTSW	3	135589452	missense	probably damaging	1.00
R9169:Nfkb1	UTSW	3	135605113	missense	probably benign	0.00
X0050:Nfkb1	UTSW	3	135606623	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGCTTTACACTCTGGCTCACC -3'
(R):5'- AACCTGTCCCTCGACATGGGAATC -3'

Sequencing Primer
(F):5'- CATGGATGAAGACCATCTTTCAAG -3'
(R):5'- AATCCTGTGTGTGATTGGAGGC -3'

Posted On

2014-05-13