Mutagenetix > Incidental Mutations

Incidental Mutation 'R0026:Cep135'

189167

Institutional Source

Beutler Lab

Gene Symbol

Cep135

Ensembl Gene

ENSMUSG00000036403

Gene Name

centrosomal protein 135

Synonyms

LOC381644, Cep4

MMRRC Submission

038321-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0026 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

76588698-76646466 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 76606734 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 353 (R353*)

Ref Sequence

ENSEMBL: ENSMUSP00000112602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]

Predicted Effect

probably null
Transcript: ENSMUST00000049060
AA Change: R353*

SMART Domains

Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: R353*

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121979
AA Change: R353*

SMART Domains

Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: R353*

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130651

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

93% (70/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,066,805	I585N	possibly damaging	Het
4931408C20Rik	T	A	1: 26,683,369	D910V	probably benign	Het
A830005F24Rik	C	T	13: 48,514,372		probably benign	Het
Abca16	C	T	7: 120,477,923		probably benign	Het
Acot10	G	A	15: 20,666,236	L140F	probably benign	Het
Adam19	G	T	11: 46,136,259	C573F	probably damaging	Het
Aff3	A	G	1: 38,203,893	S948P	probably benign	Het
Anxa3	T	A	5: 96,838,401	Y300N	probably benign	Het
BC016579	T	C	16: 45,640,367	T113A	probably benign	Het
Bmpr1b	A	G	3: 141,870,733	L113P	probably benign	Het
Casq1	T	C	1: 172,219,400		probably benign	Het
Cdc16	T	A	8: 13,759,130		probably null	Het
Cma1	A	T	14: 55,942,164	C188S	probably damaging	Het
Csf3r	A	G	4: 126,031,884	T151A	probably benign	Het
Cyp4b1	C	T	4: 115,647,521	G56D	possibly damaging	Het
Dbn1	T	C	13: 55,477,784	E275G	probably damaging	Het
Dlgap2	C	T	8: 14,727,363	Q203*	probably null	Het
Ephb3	A	G	16: 21,214,917	D251G	probably damaging	Het
Fancd2os	G	T	6: 113,597,691	T118N	probably damaging	Het
Gm10801	T	C	2: 98,663,909		probably benign	Het
Got1l1	C	T	8: 27,200,248	V132I	probably benign	Het
H2-M9	T	C	17: 36,641,527		probably benign	Het
Ibtk	A	G	9: 85,690,303	V1278A	probably benign	Het
Kctd3	T	C	1: 188,976,621	T519A	probably damaging	Het
Lgsn	T	A	1: 31,203,443	V202D	probably damaging	Het
Madd	A	G	2: 91,175,708	F381L	possibly damaging	Het
Map1s	G	A	8: 70,914,638	G729D	probably damaging	Het
Mlycd	A	G	8: 119,410,435	I465V	probably benign	Het
Mrgprb1	T	C	7: 48,447,204	R108G	possibly damaging	Het
Mrgprx2	T	A	7: 48,482,023	H106L	possibly damaging	Het
Ncor1	T	C	11: 62,438,429	Y6C	probably damaging	Het
Nfkb1	T	C	3: 135,591,573	D773G	probably damaging	Het
Nxnl1	A	G	8: 71,566,573	S3P	probably damaging	Het
Olfr109	T	A	17: 37,466,803	V199D	probably damaging	Het
Olfr921	G	A	9: 38,775,596	V114I	probably benign	Het
Otud7a	T	C	7: 63,735,801	F338L	probably benign	Het
Pdcl3	T	A	1: 38,991,280	L14Q	probably damaging	Het
Pla2g7	T	A	17: 43,594,930		probably benign	Het
Prpf31	T	A	7: 3,639,668	N413K	probably benign	Het
Rapgef5	T	C	12: 117,689,161	S307P	probably benign	Het
Relt	C	A	7: 100,850,221	E164*	probably null	Het
Rnf185	T	C	11: 3,426,617	D86G	probably damaging	Het
Rrm2b	T	C	15: 37,953,741	E21G	probably benign	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Senp1	T	C	15: 98,076,668	R88G	probably damaging	Het
Skint5	A	T	4: 113,546,468		probably benign	Het
Slc35b1	T	C	11: 95,390,642	S294P	probably benign	Het
Slc5a2	T	A	7: 128,270,053	I335N	probably damaging	Het
Sstr1	T	A	12: 58,212,858	M89K	probably damaging	Het
Szt2	A	T	4: 118,384,772	S1612R	possibly damaging	Het
Taf1c	T	C	8: 119,604,236		probably null	Het
Taf1d	T	A	9: 15,308,648	S64R	probably damaging	Het
Tmem125	A	G	4: 118,542,073	S54P	possibly damaging	Het
Ttf1	T	A	2: 29,071,349	I583N	possibly damaging	Het
Uchl4	A	T	9: 64,235,371		probably null	Het
Unc5b	A	T	10: 60,774,592	I482N	possibly damaging	Het
Unc80	C	A	1: 66,521,584	Q824K	probably benign	Het
Utrn	T	C	10: 12,726,196		probably benign	Het
Vmn2r61	T	G	7: 42,275,474	I484R	possibly damaging	Het
Vps13b	T	C	15: 35,923,301	I3774T	possibly damaging	Het
Yipf1	T	A	4: 107,345,160	L240*	probably null	Het

Other mutations in Cep135

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Cep135	APN	5	76601459	missense	probably damaging	0.98
IGL01154:Cep135	APN	5	76606796	splice site	probably benign
IGL01323:Cep135	APN	5	76591765	missense	probably benign	0.29
IGL01599:Cep135	APN	5	76593347	missense	possibly damaging	0.93
IGL01923:Cep135	APN	5	76640982	makesense	probably null
IGL02178:Cep135	APN	5	76595474	missense	probably damaging	1.00
IGL02276:Cep135	APN	5	76634246	missense	probably benign	0.00
IGL02344:Cep135	APN	5	76616821	missense	probably benign
IGL02394:Cep135	APN	5	76631471	missense	probably benign	0.02
IGL02740:Cep135	APN	5	76638268	critical splice donor site	probably null
IGL02832:Cep135	APN	5	76640949	missense	probably damaging	0.98
R0060:Cep135	UTSW	5	76621350	missense	probably benign	0.20
R0325:Cep135	UTSW	5	76615743	missense	probably damaging	0.98
R0336:Cep135	UTSW	5	76601502	missense	probably benign	0.07
R0564:Cep135	UTSW	5	76615710	missense	probably damaging	1.00
R0564:Cep135	UTSW	5	76638949	missense	probably benign	0.03
R0600:Cep135	UTSW	5	76621305	missense	probably benign
R0636:Cep135	UTSW	5	76615657	missense	probably benign	0.07
R0704:Cep135	UTSW	5	76630949	missense	possibly damaging	0.62
R0835:Cep135	UTSW	5	76615706	missense	probably benign	0.40
R1015:Cep135	UTSW	5	76640997	critical splice donor site	probably null
R1167:Cep135	UTSW	5	76624637	missense	probably damaging	1.00
R1252:Cep135	UTSW	5	76594115	missense	possibly damaging	0.67
R1554:Cep135	UTSW	5	76634213	nonsense	probably null
R1770:Cep135	UTSW	5	76603195	missense	possibly damaging	0.95
R1804:Cep135	UTSW	5	76636932	missense	probably benign	0.22
R1968:Cep135	UTSW	5	76624747	missense	possibly damaging	0.96
R1987:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R1996:Cep135	UTSW	5	76632266	missense	probably benign	0.08
R2004:Cep135	UTSW	5	76632329	critical splice donor site	probably null
R2178:Cep135	UTSW	5	76631450	missense	probably benign	0.00
R2305:Cep135	UTSW	5	76595389	splice site	probably benign
R2679:Cep135	UTSW	5	76624660	missense	probably benign
R3125:Cep135	UTSW	5	76621363	critical splice donor site	probably null
R3623:Cep135	UTSW	5	76624739	missense	probably benign	0.00
R4359:Cep135	UTSW	5	76611714	missense	possibly damaging	0.47
R4407:Cep135	UTSW	5	76624667	missense	probably benign
R4561:Cep135	UTSW	5	76638193	missense	possibly damaging	0.95
R4666:Cep135	UTSW	5	76616854	missense	probably benign
R4945:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R5105:Cep135	UTSW	5	76594092	missense	probably benign	0.00
R5117:Cep135	UTSW	5	76631429	missense	probably benign	0.01
R5176:Cep135	UTSW	5	76637026	missense	probably benign	0.04
R5194:Cep135	UTSW	5	76615777	missense	probably benign	0.05
R5233:Cep135	UTSW	5	76591843	small deletion	probably benign
R5275:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5295:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5412:Cep135	UTSW	5	76616862	missense	probably benign	0.00
R5427:Cep135	UTSW	5	76638202	missense	probably benign	0.00
R5801:Cep135	UTSW	5	76630676	missense	probably damaging	1.00
R5975:Cep135	UTSW	5	76640890	missense	possibly damaging	0.94
R6087:Cep135	UTSW	5	76615791	critical splice donor site	probably null
R6176:Cep135	UTSW	5	76624643	missense	probably benign
R6210:Cep135	UTSW	5	76624723	missense	probably benign	0.15
R6456:Cep135	UTSW	5	76591724	start gained	probably benign
R6467:Cep135	UTSW	5	76621340	missense	possibly damaging	0.50
R6622:Cep135	UTSW	5	76640968	missense	probably benign	0.00
R6650:Cep135	UTSW	5	76633701	missense	possibly damaging	0.77
R6838:Cep135	UTSW	5	76632215	missense	probably damaging	1.00
R7028:Cep135	UTSW	5	76616848	missense	probably benign
R7049:Cep135	UTSW	5	76606738	missense	probably benign	0.01
R7095:Cep135	UTSW	5	76594058	missense	probably benign	0.10
R7207:Cep135	UTSW	5	76632243	missense	probably benign	0.00
R7330:Cep135	UTSW	5	76606745	nonsense	probably null
R7369:Cep135	UTSW	5	76593253	missense	possibly damaging	0.94
R7741:Cep135	UTSW	5	76630970	missense	probably damaging	0.99
R7850:Cep135	UTSW	5	76591873	critical splice donor site	probably null
R7869:Cep135	UTSW	5	76640956	missense	probably benign	0.00
R7923:Cep135	UTSW	5	76609692	missense	possibly damaging	0.90
R8303:Cep135	UTSW	5	76611728	missense	probably damaging	1.00
R8312:Cep135	UTSW	5	76636899	missense	probably damaging	1.00
R8424:Cep135	UTSW	5	76594059	missense	possibly damaging	0.64
R8490:Cep135	UTSW	5	76638207	missense	probably benign	0.00
Z1177:Cep135	UTSW	5	76591826	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGGCTGAGCATTAGATTCAAATCC -3'
(R):5'- ATGGAATTGCAAAATCACACTGTGGAC -3'

Sequencing Primer
(F):5'- GAGCATTAGATTCAAATCCCAGGC -3'
(R):5'- cccccgacagtaggtgag -3'

Posted On

2014-05-13