Mutagenetix > Incidental Mutation

Incidental Mutation 'R0026:Taf1c'

189178

Institutional Source

Beutler Lab

Gene Symbol

Taf1c

Ensembl Gene

ENSMUSG00000031832

Gene Name

TATA-box binding protein associated factor, RNA polymerase I, C

Synonyms

mTAFI95

MMRRC Submission

038321-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R0026 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

119597871-119605222 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 119604236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000090789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000147964]

AlphaFold

Q6PDZ2

Predicted Effect

probably null
Transcript: ENSMUST00000093099

SMART Domains

Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832

Domain	Start	End	E-Value	Type
low complexity region	60	79	N/A	INTRINSIC
SCOP:d1k32a3	253	389	2e-3	SMART
Blast:WD40	301	340	2e-15	BLAST
low complexity region	457	472	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	520	535	N/A	INTRINSIC
low complexity region	724	732	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144379

Predicted Effect

probably benign
Transcript: ENSMUST00000147964

SMART Domains

Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

Domain	Start	End	E-Value	Type
low complexity region	60	79	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212929

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

93% (70/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,066,805	I585N	possibly damaging	Het
4931408C20Rik	T	A	1: 26,683,369	D910V	probably benign	Het
A830005F24Rik	C	T	13: 48,514,372		probably benign	Het
Abca16	C	T	7: 120,477,923		probably benign	Het
Acot10	G	A	15: 20,666,236	L140F	probably benign	Het
Adam19	G	T	11: 46,136,259	C573F	probably damaging	Het
Aff3	A	G	1: 38,203,893	S948P	probably benign	Het
Anxa3	T	A	5: 96,838,401	Y300N	probably benign	Het
BC016579	T	C	16: 45,640,367	T113A	probably benign	Het
Bmpr1b	A	G	3: 141,870,733	L113P	probably benign	Het
Casq1	T	C	1: 172,219,400		probably benign	Het
Cdc16	T	A	8: 13,759,130		probably null	Het
Cep135	C	T	5: 76,606,734	R353*	probably null	Het
Cma1	A	T	14: 55,942,164	C188S	probably damaging	Het
Csf3r	A	G	4: 126,031,884	T151A	probably benign	Het
Cyp4b1	C	T	4: 115,647,521	G56D	possibly damaging	Het
Dbn1	T	C	13: 55,477,784	E275G	probably damaging	Het
Dlgap2	C	T	8: 14,727,363	Q203*	probably null	Het
Ephb3	A	G	16: 21,214,917	D251G	probably damaging	Het
Fancd2os	G	T	6: 113,597,691	T118N	probably damaging	Het
Gm10801	T	C	2: 98,663,909		probably benign	Het
Got1l1	C	T	8: 27,200,248	V132I	probably benign	Het
H2-M9	T	C	17: 36,641,527		probably benign	Het
Ibtk	A	G	9: 85,690,303	V1278A	probably benign	Het
Kctd3	T	C	1: 188,976,621	T519A	probably damaging	Het
Lgsn	T	A	1: 31,203,443	V202D	probably damaging	Het
Madd	A	G	2: 91,175,708	F381L	possibly damaging	Het
Map1s	G	A	8: 70,914,638	G729D	probably damaging	Het
Mlycd	A	G	8: 119,410,435	I465V	probably benign	Het
Mrgprb1	T	C	7: 48,447,204	R108G	possibly damaging	Het
Mrgprx2	T	A	7: 48,482,023	H106L	possibly damaging	Het
Ncor1	T	C	11: 62,438,429	Y6C	probably damaging	Het
Nfkb1	T	C	3: 135,591,573	D773G	probably damaging	Het
Nxnl1	A	G	8: 71,566,573	S3P	probably damaging	Het
Olfr109	T	A	17: 37,466,803	V199D	probably damaging	Het
Olfr921	G	A	9: 38,775,596	V114I	probably benign	Het
Otud7a	T	C	7: 63,735,801	F338L	probably benign	Het
Pdcl3	T	A	1: 38,991,280	L14Q	probably damaging	Het
Pla2g7	T	A	17: 43,594,930		probably benign	Het
Prpf31	T	A	7: 3,639,668	N413K	probably benign	Het
Rapgef5	T	C	12: 117,689,161	S307P	probably benign	Het
Relt	C	A	7: 100,850,221	E164*	probably null	Het
Rnf185	T	C	11: 3,426,617	D86G	probably damaging	Het
Rrm2b	T	C	15: 37,953,741	E21G	probably benign	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Senp1	T	C	15: 98,076,668	R88G	probably damaging	Het
Skint5	A	T	4: 113,546,468		probably benign	Het
Slc35b1	T	C	11: 95,390,642	S294P	probably benign	Het
Slc5a2	T	A	7: 128,270,053	I335N	probably damaging	Het
Sstr1	T	A	12: 58,212,858	M89K	probably damaging	Het
Szt2	A	T	4: 118,384,772	S1612R	possibly damaging	Het
Taf1d	T	A	9: 15,308,648	S64R	probably damaging	Het
Tmem125	A	G	4: 118,542,073	S54P	possibly damaging	Het
Ttf1	T	A	2: 29,071,349	I583N	possibly damaging	Het
Uchl4	A	T	9: 64,235,371		probably null	Het
Unc5b	A	T	10: 60,774,592	I482N	possibly damaging	Het
Unc80	C	A	1: 66,521,584	Q824K	probably benign	Het
Utrn	T	C	10: 12,726,196		probably benign	Het
Vmn2r61	T	G	7: 42,275,474	I484R	possibly damaging	Het
Vps13b	T	C	15: 35,923,301	I3774T	possibly damaging	Het
Yipf1	T	A	4: 107,345,160	L240*	probably null	Het

Other mutations in Taf1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Taf1c	APN	8	119601328	missense	possibly damaging	0.80
IGL01098:Taf1c	APN	8	119602841	missense	probably damaging	0.98
IGL01287:Taf1c	APN	8	119601192	missense	probably benign	0.01
IGL02339:Taf1c	APN	8	119604280	missense	probably damaging	1.00
IGL02642:Taf1c	APN	8	119599057	missense	probably benign
IGL02954:Taf1c	APN	8	119600486	missense	probably damaging	1.00
R0031:Taf1c	UTSW	8	119599090	missense	probably benign	0.00
R0087:Taf1c	UTSW	8	119600987	missense	probably damaging	1.00
R0197:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R0701:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R0883:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R2200:Taf1c	UTSW	8	119598678	missense	probably benign
R3726:Taf1c	UTSW	8	119603070	missense	probably damaging	1.00
R3765:Taf1c	UTSW	8	119600485	nonsense	probably null
R3916:Taf1c	UTSW	8	119600505	missense	probably damaging	1.00
R4368:Taf1c	UTSW	8	119599316	missense	possibly damaging	0.60
R4470:Taf1c	UTSW	8	119599622	missense	probably benign
R4501:Taf1c	UTSW	8	119599429	missense	probably damaging	1.00
R4661:Taf1c	UTSW	8	119598850	missense	probably damaging	0.99
R4741:Taf1c	UTSW	8	119603395	unclassified	probably benign
R4938:Taf1c	UTSW	8	119598798	missense	probably benign	0.26
R5481:Taf1c	UTSW	8	119599240	missense	probably damaging	1.00
R6335:Taf1c	UTSW	8	119601779	missense	probably damaging	1.00
R6517:Taf1c	UTSW	8	119604247	missense	possibly damaging	0.59
R7083:Taf1c	UTSW	8	119600668	missense	probably damaging	1.00
R7351:Taf1c	UTSW	8	119599000	missense	probably damaging	0.97
R8056:Taf1c	UTSW	8	119603463	missense	probably benign	0.13
R8170:Taf1c	UTSW	8	119602826	splice site	probably null
R8279:Taf1c	UTSW	8	119599011	missense	probably benign
R8382:Taf1c	UTSW	8	119603050	missense	probably damaging	1.00
R8492:Taf1c	UTSW	8	119598717	missense	probably benign	0.13
R9375:Taf1c	UTSW	8	119598654	missense	probably damaging	0.99
Z1177:Taf1c	UTSW	8	119598827	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGCAAGTCAAGGCCACAC -3'
(R):5'- ACATTCTCTCCAGGATGGACTTCCC -3'

Sequencing Primer
(F):5'- CCATAACTGGAAGTCCCTTAGGTG -3'
(R):5'- GATGGACTTCCCTGGCAC -3'

Posted On

2014-05-13