Mutagenetix > Incidental Mutations

Incidental Mutation 'R0026:Ncor1'

189184

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

MMRRC Submission

038321-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0026 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62438429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 6 (Y6C)

Ref Sequence

ENSEMBL: ENSMUSP00000123822 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000069456] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000127471] [ENSMUST00000141447] [ENSMUST00000155486]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018645
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069456
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068974
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101066
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101067
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000101068

Predicted Effect

probably damaging
Transcript: ENSMUST00000127471
AA Change: Y6C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121806
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	508	545	N/A	INTRINSIC
low complexity region	594	618	N/A	INTRINSIC
SANT	625	673	3.29e-14	SMART
low complexity region	711	732	N/A	INTRINSIC
low complexity region	756	773	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141447
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123822
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155486
AA Change: Y6C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122647
Gene: ENSMUSG00000018501
AA Change: Y6C

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	311	338	N/A	INTRINSIC
low complexity region	358	375	N/A	INTRINSIC
SANT	446	494	2.76e-7	SMART
coiled coil region	516	541	N/A	INTRINSIC

Meta Mutation Damage Score

0.1185

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

93% (70/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,066,805	I585N	possibly damaging	Het
4931408C20Rik	T	A	1: 26,683,369	D910V	probably benign	Het
A830005F24Rik	C	T	13: 48,514,372		probably benign	Het
Abca16	C	T	7: 120,477,923		probably benign	Het
Acot10	G	A	15: 20,666,236	L140F	probably benign	Het
Adam19	G	T	11: 46,136,259	C573F	probably damaging	Het
Aff3	A	G	1: 38,203,893	S948P	probably benign	Het
Anxa3	T	A	5: 96,838,401	Y300N	probably benign	Het
BC016579	T	C	16: 45,640,367	T113A	probably benign	Het
Bmpr1b	A	G	3: 141,870,733	L113P	probably benign	Het
Casq1	T	C	1: 172,219,400		probably benign	Het
Cdc16	T	A	8: 13,759,130		probably null	Het
Cep135	C	T	5: 76,606,734	R353*	probably null	Het
Cma1	A	T	14: 55,942,164	C188S	probably damaging	Het
Csf3r	A	G	4: 126,031,884	T151A	probably benign	Het
Cyp4b1	C	T	4: 115,647,521	G56D	possibly damaging	Het
Dbn1	T	C	13: 55,477,784	E275G	probably damaging	Het
Dlgap2	C	T	8: 14,727,363	Q203*	probably null	Het
Ephb3	A	G	16: 21,214,917	D251G	probably damaging	Het
Fancd2os	G	T	6: 113,597,691	T118N	probably damaging	Het
Gm10801	T	C	2: 98,663,909		probably benign	Het
Got1l1	C	T	8: 27,200,248	V132I	probably benign	Het
H2-M9	T	C	17: 36,641,527		probably benign	Het
Ibtk	A	G	9: 85,690,303	V1278A	probably benign	Het
Kctd3	T	C	1: 188,976,621	T519A	probably damaging	Het
Lgsn	T	A	1: 31,203,443	V202D	probably damaging	Het
Madd	A	G	2: 91,175,708	F381L	possibly damaging	Het
Map1s	G	A	8: 70,914,638	G729D	probably damaging	Het
Mlycd	A	G	8: 119,410,435	I465V	probably benign	Het
Mrgprb1	T	C	7: 48,447,204	R108G	possibly damaging	Het
Mrgprx2	T	A	7: 48,482,023	H106L	possibly damaging	Het
Nfkb1	T	C	3: 135,591,573	D773G	probably damaging	Het
Nxnl1	A	G	8: 71,566,573	S3P	probably damaging	Het
Olfr109	T	A	17: 37,466,803	V199D	probably damaging	Het
Olfr921	G	A	9: 38,775,596	V114I	probably benign	Het
Otud7a	T	C	7: 63,735,801	F338L	probably benign	Het
Pdcl3	T	A	1: 38,991,280	L14Q	probably damaging	Het
Pla2g7	T	A	17: 43,594,930		probably benign	Het
Prpf31	T	A	7: 3,639,668	N413K	probably benign	Het
Rapgef5	T	C	12: 117,689,161	S307P	probably benign	Het
Relt	C	A	7: 100,850,221	E164*	probably null	Het
Rnf185	T	C	11: 3,426,617	D86G	probably damaging	Het
Rrm2b	T	C	15: 37,953,741	E21G	probably benign	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Senp1	T	C	15: 98,076,668	R88G	probably damaging	Het
Skint5	A	T	4: 113,546,468		probably benign	Het
Slc35b1	T	C	11: 95,390,642	S294P	probably benign	Het
Slc5a2	T	A	7: 128,270,053	I335N	probably damaging	Het
Sstr1	T	A	12: 58,212,858	M89K	probably damaging	Het
Szt2	A	T	4: 118,384,772	S1612R	possibly damaging	Het
Taf1c	T	C	8: 119,604,236		probably null	Het
Taf1d	T	A	9: 15,308,648	S64R	probably damaging	Het
Tmem125	A	G	4: 118,542,073	S54P	possibly damaging	Het
Ttf1	T	A	2: 29,071,349	I583N	possibly damaging	Het
Uchl4	A	T	9: 64,235,371		probably null	Het
Unc5b	A	T	10: 60,774,592	I482N	possibly damaging	Het
Unc80	C	A	1: 66,521,584	Q824K	probably benign	Het
Utrn	T	C	10: 12,726,196		probably benign	Het
Vmn2r61	T	G	7: 42,275,474	I484R	possibly damaging	Het
Vps13b	T	C	15: 35,923,301	I3774T	possibly damaging	Het
Yipf1	T	A	4: 107,345,160	L240*	probably null	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
laggard	UTSW	11	62369304	missense	probably damaging	1.00
Shortstep	UTSW	11	62334541	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62334631	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	splice site	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62343341	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62339000	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	splice site	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	splice site	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62317968	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62333926	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62334533	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62349495	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62333855	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62383244	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62433611	small deletion	probably benign
R8728:Ncor1	UTSW	11	62330859	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8821:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62343045	nonsense	probably null
R9111:Ncor1	UTSW	11	62389759	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62333846	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62325550	nonsense	probably null
R9467:Ncor1	UTSW	11	62433611	small insertion	probably benign
R9467:Ncor1	UTSW	11	62433622	small insertion	probably benign
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACGGCTCTGTGCCTGTGTCT -3'
(R):5'- TGAGGAGCTTTGCCTGGAAATTGTG -3'

Sequencing Primer
(F):5'- ctcccaacttccagcctc -3'
(R):5'- CTGTTCTATGTAGGTTGCTTCCT -3'

Posted On

2014-05-13