Incidental Mutation 'R0026:H2-M9'
ID 189192
Institutional Source Beutler Lab
Gene Symbol H2-M9
Ensembl Gene ENSMUSG00000067201
Gene Name histocompatibility 2, M region locus 9
Synonyms M9
MMRRC Submission 038321-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R0026 (G1)
Quality Score 73
Status Validated
Chromosome 17
Chromosomal Location 36950177-36953558 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 36952419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087165] [ENSMUST00000087167]
AlphaFold O19442
Predicted Effect probably benign
Transcript: ENSMUST00000087165
SMART Domains Protein: ENSMUSP00000084409
Gene: ENSMUSG00000067201

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.4e-45 PFAM
transmembrane domain 216 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087167
SMART Domains Protein: ENSMUSP00000084411
Gene: ENSMUSG00000067201

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 5.3e-44 PFAM
IGc1 222 293 5.73e-22 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,772,566 (GRCm39) I585N possibly damaging Het
A830005F24Rik C T 13: 48,667,848 (GRCm39) probably benign Het
Abca16 C T 7: 120,077,146 (GRCm39) probably benign Het
Acot10 G A 15: 20,666,322 (GRCm39) L140F probably benign Het
Adam19 G T 11: 46,027,086 (GRCm39) C573F probably damaging Het
Aff3 A G 1: 38,242,974 (GRCm39) S948P probably benign Het
Anxa3 T A 5: 96,986,260 (GRCm39) Y300N probably benign Het
BC016579 T C 16: 45,460,730 (GRCm39) T113A probably benign Het
Bmpr1b A G 3: 141,576,494 (GRCm39) L113P probably benign Het
Casq1 T C 1: 172,046,967 (GRCm39) probably benign Het
Cdc16 T A 8: 13,809,130 (GRCm39) probably null Het
Cep135 C T 5: 76,754,581 (GRCm39) R353* probably null Het
Cma1 A T 14: 56,179,621 (GRCm39) C188S probably damaging Het
Csf3r A G 4: 125,925,677 (GRCm39) T151A probably benign Het
Cyp4b1 C T 4: 115,504,718 (GRCm39) G56D possibly damaging Het
Dbn1 T C 13: 55,625,597 (GRCm39) E275G probably damaging Het
Dlgap2 C T 8: 14,777,363 (GRCm39) Q203* probably null Het
Ephb3 A G 16: 21,033,667 (GRCm39) D251G probably damaging Het
Fancd2os G T 6: 113,574,652 (GRCm39) T118N probably damaging Het
Gm10801 T C 2: 98,494,254 (GRCm39) probably benign Het
Got1l1 C T 8: 27,690,276 (GRCm39) V132I probably benign Het
Ibtk A G 9: 85,572,356 (GRCm39) V1278A probably benign Het
Kctd3 T C 1: 188,708,818 (GRCm39) T519A probably damaging Het
Lgsn T A 1: 31,242,524 (GRCm39) V202D probably damaging Het
Madd A G 2: 91,006,053 (GRCm39) F381L possibly damaging Het
Map1s G A 8: 71,367,282 (GRCm39) G729D probably damaging Het
Mlycd A G 8: 120,137,174 (GRCm39) I465V probably benign Het
Mrgprb1 T C 7: 48,096,952 (GRCm39) R108G possibly damaging Het
Mrgprx2 T A 7: 48,131,771 (GRCm39) H106L possibly damaging Het
Ncor1 T C 11: 62,329,255 (GRCm39) Y6C probably damaging Het
Nfkb1 T C 3: 135,297,334 (GRCm39) D773G probably damaging Het
Nxnl1 A G 8: 72,019,217 (GRCm39) S3P probably damaging Het
Or12d17 T A 17: 37,777,694 (GRCm39) V199D probably damaging Het
Or8b54 G A 9: 38,686,892 (GRCm39) V114I probably benign Het
Otud7a T C 7: 63,385,549 (GRCm39) F338L probably benign Het
Pdcl3 T A 1: 39,030,361 (GRCm39) L14Q probably damaging Het
Pla2g7 T A 17: 43,905,821 (GRCm39) probably benign Het
Prpf31 T A 7: 3,642,667 (GRCm39) N413K probably benign Het
Rapgef5 T C 12: 117,652,896 (GRCm39) S307P probably benign Het
Relt C A 7: 100,499,428 (GRCm39) E164* probably null Het
Rnf185 T C 11: 3,376,617 (GRCm39) D86G probably damaging Het
Rrm2b T C 15: 37,953,985 (GRCm39) E21G probably benign Het
Scn5a A G 9: 119,351,632 (GRCm39) I783T probably damaging Het
Senp1 T C 15: 97,974,549 (GRCm39) R88G probably damaging Het
Skint5 A T 4: 113,403,665 (GRCm39) probably benign Het
Slc35b1 T C 11: 95,281,468 (GRCm39) S294P probably benign Het
Slc5a2 T A 7: 127,869,225 (GRCm39) I335N probably damaging Het
Spata31e2 T A 1: 26,722,450 (GRCm39) D910V probably benign Het
Sstr1 T A 12: 58,259,644 (GRCm39) M89K probably damaging Het
Szt2 A T 4: 118,241,969 (GRCm39) S1612R possibly damaging Het
Taf1c T C 8: 120,330,975 (GRCm39) probably null Het
Taf1d T A 9: 15,219,944 (GRCm39) S64R probably damaging Het
Tmem125 A G 4: 118,399,270 (GRCm39) S54P possibly damaging Het
Ttf1 T A 2: 28,961,361 (GRCm39) I583N possibly damaging Het
Uchl4 A T 9: 64,142,653 (GRCm39) probably null Het
Unc5b A T 10: 60,610,371 (GRCm39) I482N possibly damaging Het
Unc80 C A 1: 66,560,743 (GRCm39) Q824K probably benign Het
Utrn T C 10: 12,601,940 (GRCm39) probably benign Het
Vmn2r61 T G 7: 41,924,898 (GRCm39) I484R possibly damaging Het
Vps13b T C 15: 35,923,447 (GRCm39) I3774T possibly damaging Het
Yipf1 T A 4: 107,202,357 (GRCm39) L240* probably null Het
Other mutations in H2-M9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2-M9 APN 17 36,952,711 (GRCm39) splice site probably null
IGL02133:H2-M9 APN 17 36,952,629 (GRCm39) missense possibly damaging 0.95
IGL02323:H2-M9 APN 17 36,951,633 (GRCm39) missense probably damaging 1.00
IGL02957:H2-M9 APN 17 36,953,049 (GRCm39) missense probably benign 0.00
IGL03127:H2-M9 APN 17 36,951,714 (GRCm39) missense possibly damaging 0.48
R0025:H2-M9 UTSW 17 36,952,647 (GRCm39) missense probably damaging 1.00
R0926:H2-M9 UTSW 17 36,952,665 (GRCm39) missense probably damaging 0.98
R1171:H2-M9 UTSW 17 36,952,545 (GRCm39) missense probably benign 0.14
R1264:H2-M9 UTSW 17 36,953,484 (GRCm39) missense probably benign
R1995:H2-M9 UTSW 17 36,952,678 (GRCm39) missense probably damaging 1.00
R4622:H2-M9 UTSW 17 36,952,716 (GRCm39) splice site probably null
R4737:H2-M9 UTSW 17 36,951,631 (GRCm39) nonsense probably null
R4808:H2-M9 UTSW 17 36,951,684 (GRCm39) missense probably damaging 0.99
R5176:H2-M9 UTSW 17 36,952,523 (GRCm39) missense probably damaging 0.98
R6756:H2-M9 UTSW 17 36,953,227 (GRCm39) missense probably damaging 1.00
R6785:H2-M9 UTSW 17 36,953,125 (GRCm39) missense probably damaging 0.99
R7216:H2-M9 UTSW 17 36,951,594 (GRCm39) missense probably benign
R7464:H2-M9 UTSW 17 36,953,303 (GRCm39) splice site probably null
R8079:H2-M9 UTSW 17 36,953,025 (GRCm39) missense probably benign 0.39
R8688:H2-M9 UTSW 17 36,953,034 (GRCm39) missense probably damaging 1.00
R9174:H2-M9 UTSW 17 36,953,181 (GRCm39) missense probably damaging 0.99
X0018:H2-M9 UTSW 17 36,952,614 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAAGTGGAAGGAACTGCTGC -3'
(R):5'- CAGAGAACGTACTTCAGTCACGCC -3'

Sequencing Primer
(F):5'- GGAAGGAACTGCTGCTTAATTCAC -3'
(R):5'- TCACACTGAATGAGGATCTGC -3'
Posted On 2014-05-13