Mutagenetix > Incidental Mutations

Incidental Mutation 'R0595:Cadps2'

189200

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

038785-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0595 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 23321704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000163871] [ENSMUST00000166458] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000018122

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000018122

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000069074

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000069074

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115357

SMART Domains

Protein: ENSMUSP00000111014
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	806	897	1.9e-49	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115358

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115358

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115361

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125350

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125350

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000142913

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000142913

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156986

Predicted Effect

probably null
Transcript: ENSMUST00000163871

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000163871

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166458

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166458

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.9753

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,740,417	D1093E	probably damaging	Het
Aldh2	G	T	5: 121,573,500	A276D	probably damaging	Het
Aldh2	C	T	5: 121,573,501	A276T	probably damaging	Het
Aldh7a1	C	T	18: 56,546,893		probably benign	Het
Ano1	C	T	7: 144,590,153	R964H	possibly damaging	Het
Apob	G	A	12: 8,008,369	V2251I	probably benign	Het
Atp6v1e1	A	G	6: 120,801,130	V148A	probably benign	Het
Bbs9	T	A	9: 22,496,815	H73Q	probably benign	Het
Brca1	A	G	11: 101,524,887	V807A	probably benign	Het
Cacna1b	C	T	2: 24,649,989		probably benign	Het
Cep152	T	C	2: 125,595,063	Q519R	probably damaging	Het
Cep295	A	C	9: 15,332,191	Y1608*	probably null	Het
Cfap54	T	C	10: 92,884,736	I2619V	unknown	Het
Dnajb9	A	G	12: 44,208,284	V7A	probably benign	Het
Ep400	T	C	5: 110,703,542	K1358R	unknown	Het
Fbxw7	C	A	3: 84,977,367		probably null	Het
Fsip2	T	C	2: 82,946,952	Y108H	probably damaging	Het
Ggt6	T	A	11: 72,437,667	L331Q	probably damaging	Het
Ifitm1	T	A	7: 140,968,329	I25N	possibly damaging	Het
Krt75	C	T	15: 101,568,354	E367K	probably damaging	Het
Lifr	A	G	15: 7,177,469	Y487C	probably damaging	Het
Map3k6	G	T	4: 133,241,263	G59W	probably damaging	Het
Mme	A	G	3: 63,328,181	T129A	probably benign	Het
Mmp10	G	A	9: 7,508,198	E442K	probably benign	Het
Myh13	T	C	11: 67,344,846	S646P	probably benign	Het
Nbea	A	T	3: 55,628,496	I2889N	probably benign	Het
Nlrp4d	T	A	7: 10,381,045	K581N	probably benign	Het
Nr3c2	C	T	8: 76,909,604	P445S	possibly damaging	Het
Olfr487	A	T	7: 108,211,661	N289K	probably damaging	Het
Pck1	T	A	2: 173,157,029	V360E	probably damaging	Het
Plekha7	T	C	7: 116,144,968	D766G	probably damaging	Het
Prag1	A	G	8: 36,147,002	N1236S	probably damaging	Het
Prkdc	A	C	16: 15,808,088	Q3326P	probably damaging	Het
Prrc2b	T	C	2: 32,183,177	M57T	probably damaging	Het
Rb1	A	T	14: 73,273,680	F330I	probably damaging	Het
Rufy4	A	G	1: 74,140,930	E448G	possibly damaging	Het
Scn10a	T	A	9: 119,666,063	M371L	probably benign	Het
Sgta	T	C	10: 81,048,908	D189G	probably damaging	Het
Spata31d1b	A	G	13: 59,716,277	H413R	probably benign	Het
Stau2	T	C	1: 16,440,450	T95A	probably damaging	Het
Supt4a	C	T	11: 87,743,156		probably null	Het
Tanc2	A	G	11: 105,714,177		probably null	Het
Tap2	T	A	17: 34,212,354	V422D	probably damaging	Het
Tas2r138	A	G	6: 40,612,865	L149P	probably damaging	Het
Tex15	T	C	8: 33,572,617	S692P	probably damaging	Het
Tgm2	C	T	2: 158,143,042	R48H	probably damaging	Het
Ticrr	T	A	7: 79,695,563	F1725L	possibly damaging	Het
Tnpo2	T	A	8: 85,052,041	C672*	probably null	Het
Xkr9	A	G	1: 13,700,784	I175V	probably benign	Het
Zfp428	T	A	7: 24,515,378	S140T	probably benign	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTTACCATTTTGCTCAGCCAAATAA -3'
(R):5'- GTGAAACGTGCTTGAACCATTTTCTTCT -3'

Sequencing Primer
(F):5'- TGGATGCAAACTCTGAGTCTTC -3'
(R):5'- GTCTAACCTTTATTTGAGATGCCAGC -3'

Posted On

2014-05-13