Incidental Mutation 'R0595:Cadps2'
ID 189200
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 038785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0595 (G1)
Quality Score 80
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 23321703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000125350] [ENSMUST00000163871] [ENSMUST00000163871] [ENSMUST00000142913] [ENSMUST00000142913] [ENSMUST00000166458] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115357
SMART Domains Protein: ENSMUSP00000111014
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 806 897 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115361
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,790,417 (GRCm39) D1093E probably damaging Het
Aldh2 G T 5: 121,711,563 (GRCm39) A276D probably damaging Het
Aldh2 C T 5: 121,711,564 (GRCm39) A276T probably damaging Het
Aldh7a1 C T 18: 56,679,965 (GRCm39) probably benign Het
Ano1 C T 7: 144,143,890 (GRCm39) R964H possibly damaging Het
Apob G A 12: 8,058,369 (GRCm39) V2251I probably benign Het
Atp6v1e1 A G 6: 120,778,091 (GRCm39) V148A probably benign Het
Bbs9 T A 9: 22,408,111 (GRCm39) H73Q probably benign Het
Brca1 A G 11: 101,415,713 (GRCm39) V807A probably benign Het
Cacna1b C T 2: 24,540,001 (GRCm39) probably benign Het
Cep152 T C 2: 125,436,983 (GRCm39) Q519R probably damaging Het
Cep295 A C 9: 15,243,487 (GRCm39) Y1608* probably null Het
Cfap54 T C 10: 92,720,598 (GRCm39) I2619V unknown Het
Dnajb9 A G 12: 44,255,067 (GRCm39) V7A probably benign Het
Ep400 T C 5: 110,851,408 (GRCm39) K1358R unknown Het
Fbxw7 C A 3: 84,884,674 (GRCm39) probably null Het
Fsip2 T C 2: 82,777,296 (GRCm39) Y108H probably damaging Het
Ggt6 T A 11: 72,328,493 (GRCm39) L331Q probably damaging Het
Ifitm1 T A 7: 140,548,242 (GRCm39) I25N possibly damaging Het
Krt75 C T 15: 101,476,789 (GRCm39) E367K probably damaging Het
Lifr A G 15: 7,206,950 (GRCm39) Y487C probably damaging Het
Map3k6 G T 4: 132,968,574 (GRCm39) G59W probably damaging Het
Mme A G 3: 63,235,602 (GRCm39) T129A probably benign Het
Mmp10 G A 9: 7,508,199 (GRCm39) E442K probably benign Het
Myh13 T C 11: 67,235,672 (GRCm39) S646P probably benign Het
Nbea A T 3: 55,535,917 (GRCm39) I2889N probably benign Het
Nlrp4d T A 7: 10,114,972 (GRCm39) K581N probably benign Het
Nr3c2 C T 8: 77,636,233 (GRCm39) P445S possibly damaging Het
Or5p63 A T 7: 107,810,868 (GRCm39) N289K probably damaging Het
Pck1 T A 2: 172,998,822 (GRCm39) V360E probably damaging Het
Plekha7 T C 7: 115,744,203 (GRCm39) D766G probably damaging Het
Prag1 A G 8: 36,614,156 (GRCm39) N1236S probably damaging Het
Prkdc A C 16: 15,625,952 (GRCm39) Q3326P probably damaging Het
Prrc2b T C 2: 32,073,189 (GRCm39) M57T probably damaging Het
Rb1 A T 14: 73,511,120 (GRCm39) F330I probably damaging Het
Rufy4 A G 1: 74,180,089 (GRCm39) E448G possibly damaging Het
Scn10a T A 9: 119,495,129 (GRCm39) M371L probably benign Het
Sgta T C 10: 80,884,742 (GRCm39) D189G probably damaging Het
Spata31d1b A G 13: 59,864,091 (GRCm39) H413R probably benign Het
Stau2 T C 1: 16,510,674 (GRCm39) T95A probably damaging Het
Supt4a C T 11: 87,633,982 (GRCm39) probably null Het
Tanc2 A G 11: 105,605,003 (GRCm39) probably null Het
Tap2 T A 17: 34,431,328 (GRCm39) V422D probably damaging Het
Tas2r138 A G 6: 40,589,799 (GRCm39) L149P probably damaging Het
Tex15 T C 8: 34,062,645 (GRCm39) S692P probably damaging Het
Tgm2 C T 2: 157,984,962 (GRCm39) R48H probably damaging Het
Ticrr T A 7: 79,345,311 (GRCm39) F1725L possibly damaging Het
Tnpo2 T A 8: 85,778,670 (GRCm39) C672* probably null Het
Xkr9 A G 1: 13,771,008 (GRCm39) I175V probably benign Het
Zfp428 T A 7: 24,214,803 (GRCm39) S140T probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGGCTTACCATTTTGCTCAGCCAAATAA -3'
(R):5'- GTGAAACGTGCTTGAACCATTTTCTTCT -3'

Sequencing Primer
(F):5'- TGGATGCAAACTCTGAGTCTTC -3'
(R):5'- GTCTAACCTTTATTTGAGATGCCAGC -3'
Posted On 2014-05-13