Incidental Mutation 'R0595:Cadps2'
List |< first << previous [record 11 of 51] next >> last >|
ID189200
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene NameCa2+-dependent activator protein for secretion 2
SynonymsCaps2, cpd2, A230044C21Rik
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0595 (G1)
Quality Score80
Status Validated
Chromosome6
Chromosomal Location23262773-23839421 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 23321704 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000163871] [ENSMUST00000166458] [ENSMUST00000166458]
Predicted Effect probably null
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115357
SMART Domains Protein: ENSMUSP00000111014
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 806 897 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115361
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Predicted Effect probably null
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R7953:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTACCATTTTGCTCAGCCAAATAA -3'
(R):5'- GTGAAACGTGCTTGAACCATTTTCTTCT -3'

Sequencing Primer
(F):5'- TGGATGCAAACTCTGAGTCTTC -3'
(R):5'- GTCTAACCTTTATTTGAGATGCCAGC -3'
Posted On2014-05-13