Incidental Mutation 'R1682:Ap2a1'
ID 189238
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Name adaptor-related protein complex 2, alpha 1 subunit
Synonyms Adtaa
MMRRC Submission 039718-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R1682 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 44549797-44578914 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44565362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 126 (T126A)
Ref Sequence ENSEMBL: ENSMUSP00000127497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000208405]
AlphaFold P17426
Predicted Effect probably benign
Transcript: ENSMUST00000085399
AA Change: T126A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279
AA Change: T126A

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107857
AA Change: T126A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279
AA Change: T126A

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166972
AA Change: T126A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279
AA Change: T126A

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167930
AA Change: T126A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279
AA Change: T126A

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208285
Predicted Effect probably benign
Transcript: ENSMUST00000208405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208813
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,283,043 (GRCm39) D2203G probably benign Het
Acin1 A G 14: 54,901,175 (GRCm39) S629P probably damaging Het
Agbl2 T A 2: 90,614,434 (GRCm39) I22N probably benign Het
Ank1 A G 8: 23,599,343 (GRCm39) E796G probably damaging Het
Ankrd13d A G 19: 4,332,961 (GRCm39) L13P probably damaging Het
Ankrd36 T C 11: 5,557,143 (GRCm39) S364P possibly damaging Het
Apob A G 12: 8,062,365 (GRCm39) I3616V probably benign Het
Arl5a A T 2: 52,306,214 (GRCm39) N39K probably benign Het
Baiap2 G A 11: 119,888,366 (GRCm39) R334H probably damaging Het
Bbox1 T A 2: 110,122,893 (GRCm39) N132I possibly damaging Het
Bcl11b A G 12: 107,882,908 (GRCm39) L469P probably damaging Het
Brca1 A G 11: 101,416,391 (GRCm39) I581T probably damaging Het
Cacng2 T C 15: 78,002,997 (GRCm39) Y32C probably damaging Het
Capn9 G T 8: 125,338,304 (GRCm39) probably null Het
Cdh18 A G 15: 23,400,671 (GRCm39) T290A probably benign Het
Cdk5rap2 C T 4: 70,220,387 (GRCm39) V593I possibly damaging Het
Cep128 G C 12: 91,197,596 (GRCm39) D91E probably damaging Het
Cep295 T C 9: 15,245,217 (GRCm39) M1080V probably benign Het
Coq8b T A 7: 26,939,549 (GRCm39) M193K probably benign Het
Csn1s2b A G 5: 87,970,162 (GRCm39) Y131C probably damaging Het
D130043K22Rik T C 13: 25,066,539 (GRCm39) S779P probably damaging Het
Dgat1 C T 15: 76,387,219 (GRCm39) C356Y probably benign Het
Dipk1c A T 18: 84,754,988 (GRCm39) I155F possibly damaging Het
Dnah12 A T 14: 26,500,840 (GRCm39) T1543S possibly damaging Het
Dock3 T C 9: 106,851,040 (GRCm39) S821G probably damaging Het
Dock4 G A 12: 40,775,779 (GRCm39) C574Y probably damaging Het
Dr1 T C 5: 108,417,604 (GRCm39) I50T probably damaging Het
Dzip3 A T 16: 48,778,780 (GRCm39) probably null Het
Eln C A 5: 134,732,636 (GRCm39) *861L probably null Het
Eml6 T A 11: 29,709,065 (GRCm39) H24L probably benign Het
Eps8l3 A C 3: 107,798,622 (GRCm39) T503P possibly damaging Het
Fgf1 C A 18: 38,974,985 (GRCm39) D155Y possibly damaging Het
Fkbp15 A T 4: 62,242,431 (GRCm39) M507K probably damaging Het
Flnb A T 14: 7,913,121 (GRCm38) R1463S probably benign Het
Fras1 C T 5: 96,793,732 (GRCm39) T1018I probably benign Het
Gm10803 T A 2: 93,394,533 (GRCm39) C102S probably damaging Het
Gpatch1 C A 7: 35,002,812 (GRCm39) V233L possibly damaging Het
Gramd1a T C 7: 30,842,325 (GRCm39) probably null Het
Gsk3a T C 7: 24,935,133 (GRCm39) T106A possibly damaging Het
Hap1 A G 11: 100,240,302 (GRCm39) V136A possibly damaging Het
Helq A T 5: 100,940,679 (GRCm39) S307T probably benign Het
Herc2 T A 7: 55,738,148 (GRCm39) S264T possibly damaging Het
Htr4 A G 18: 62,561,137 (GRCm39) M133V possibly damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Jakmip2 A G 18: 43,714,896 (GRCm39) probably null Het
Ldhd T A 8: 112,354,745 (GRCm39) S358C possibly damaging Het
Lrp1 A T 10: 127,410,201 (GRCm39) V1515E probably damaging Het
Ltbp3 A G 19: 5,801,782 (GRCm39) D700G probably benign Het
Magel2 T G 7: 62,029,983 (GRCm39) S962R unknown Het
Map2 A C 1: 66,454,781 (GRCm39) probably null Het
Map3k1 T A 13: 111,893,684 (GRCm39) E704V probably damaging Het
Mrpl39 A T 16: 84,527,347 (GRCm39) V180D probably damaging Het
Myef2 T C 2: 124,939,978 (GRCm39) M383V probably damaging Het
Myh3 A G 11: 66,979,891 (GRCm39) Y610C probably damaging Het
Or10ak7 A G 4: 118,791,778 (GRCm39) L89P probably damaging Het
Or51h1 T C 7: 102,308,904 (GRCm39) V292A probably damaging Het
Or8g54 T A 9: 39,706,954 (GRCm39) Y94* probably null Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pabpc1 T A 15: 36,605,785 (GRCm39) N135I possibly damaging Het
Pcsk6 T A 7: 65,559,976 (GRCm39) H100Q probably damaging Het
Pdss1 A G 2: 22,805,531 (GRCm39) K270E probably damaging Het
Pigx A T 16: 31,906,268 (GRCm39) S18T possibly damaging Het
Plbd2 T A 5: 120,623,849 (GRCm39) T558S probably damaging Het
Plppr1 A T 4: 49,325,617 (GRCm39) probably null Het
Plppr2 T A 9: 21,855,717 (GRCm39) V230E possibly damaging Het
Pola2 A G 19: 6,003,091 (GRCm39) probably null Het
Ppp2r3d A G 9: 101,089,505 (GRCm39) S273P probably benign Het
Prkdc A G 16: 15,494,853 (GRCm39) E741G probably benign Het
Prom2 C A 2: 127,382,082 (GRCm39) V111L possibly damaging Het
Rapgef4 A G 2: 72,056,912 (GRCm39) D557G possibly damaging Het
Rgs10 T C 7: 127,975,694 (GRCm39) T158A probably benign Het
Rnf123 A C 9: 107,954,597 (GRCm39) Y40D probably benign Het
Rnf14 A G 18: 38,441,242 (GRCm39) T211A probably benign Het
Rp1l1 T A 14: 64,266,417 (GRCm39) S668T probably damaging Het
Sema6d T A 2: 124,507,069 (GRCm39) L946Q probably benign Het
Sgcd T G 11: 47,085,869 (GRCm39) K94Q probably benign Het
Skor2 A T 18: 76,947,211 (GRCm39) D311V unknown Het
Slc34a1 A T 13: 23,996,623 (GRCm39) I43F probably damaging Het
Spdye4c C A 2: 128,434,542 (GRCm39) P40T probably damaging Het
Srp72 C A 5: 77,135,717 (GRCm39) Q216K possibly damaging Het
Tmem62 C T 2: 120,837,538 (GRCm39) T485I probably benign Het
Tmem94 G T 11: 115,681,056 (GRCm39) V432L probably damaging Het
Trio T C 15: 27,744,232 (GRCm39) probably null Het
Uggt2 A T 14: 119,292,055 (GRCm39) D581E probably benign Het
Unc5d T A 8: 29,249,109 (GRCm39) S319C probably damaging Het
Vmn1r211 T C 13: 23,035,813 (GRCm39) I285V probably damaging Het
Vmn2r68 A G 7: 84,882,574 (GRCm39) Y393H possibly damaging Het
Vmn2r99 A C 17: 19,598,207 (GRCm39) N77T probably damaging Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44,555,192 (GRCm39) missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44,565,713 (GRCm39) missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44,555,120 (GRCm39) missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44,555,850 (GRCm39) missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44,552,935 (GRCm39) missense probably benign
IGL03172:Ap2a1 APN 7 44,553,479 (GRCm39) missense probably benign 0.00
disaffected UTSW 7 44,565,588 (GRCm39) missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44,565,397 (GRCm39) missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44,565,397 (GRCm39) missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44,554,132 (GRCm39) missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44,553,593 (GRCm39) unclassified probably benign
R1566:Ap2a1 UTSW 7 44,552,904 (GRCm39) missense probably benign 0.02
R1745:Ap2a1 UTSW 7 44,556,369 (GRCm39) missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44,553,576 (GRCm39) missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44,553,843 (GRCm39) missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44,552,343 (GRCm39) unclassified probably benign
R4776:Ap2a1 UTSW 7 44,550,970 (GRCm39) unclassified probably benign
R4909:Ap2a1 UTSW 7 44,555,805 (GRCm39) missense probably damaging 1.00
R5040:Ap2a1 UTSW 7 44,555,228 (GRCm39) missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44,552,203 (GRCm39) missense probably benign 0.00
R5310:Ap2a1 UTSW 7 44,555,489 (GRCm39) splice site probably null
R5517:Ap2a1 UTSW 7 44,556,405 (GRCm39) missense possibly damaging 0.93
R5635:Ap2a1 UTSW 7 44,573,325 (GRCm39) intron probably benign
R6002:Ap2a1 UTSW 7 44,553,819 (GRCm39) splice site probably null
R6083:Ap2a1 UTSW 7 44,557,175 (GRCm39) missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44,565,594 (GRCm39) missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44,553,253 (GRCm39) missense probably benign
R6491:Ap2a1 UTSW 7 44,565,588 (GRCm39) missense probably damaging 1.00
R7058:Ap2a1 UTSW 7 44,550,215 (GRCm39) missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44,573,228 (GRCm39) splice site probably null
R7490:Ap2a1 UTSW 7 44,552,213 (GRCm39) missense probably benign 0.03
R7765:Ap2a1 UTSW 7 44,559,160 (GRCm39) missense probably damaging 1.00
R7831:Ap2a1 UTSW 7 44,550,436 (GRCm39) missense probably damaging 1.00
R8237:Ap2a1 UTSW 7 44,550,220 (GRCm39) missense probably damaging 1.00
R8334:Ap2a1 UTSW 7 44,554,135 (GRCm39) missense possibly damaging 0.95
R8540:Ap2a1 UTSW 7 44,553,750 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTGACCCGTCTGAAACCCTGCC -3'
(R):5'- TGGTCTAGTGCCCTTTAGCCACAG -3'

Sequencing Primer
(F):5'- ACCAGTGTCAGCCATCAGTG -3'
(R):5'- TTTAGCCACAGGTGCCCAG -3'
Posted On 2014-05-14