Mutagenetix > Incidental Mutation

Incidental Mutation 'R1682:Vmn2r68'

189242

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

039718-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R1682 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85233366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 393 (Y393H)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061074
AA Change: Y393H

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: Y393H

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,392,217	D2203G	probably benign	Het
Acin1	A	G	14: 54,663,718	S629P	probably damaging	Het
Agbl2	T	A	2: 90,784,090	I22N	probably benign	Het
Ank1	A	G	8: 23,109,327	E796G	probably damaging	Het
Ankrd13d	A	G	19: 4,282,933	L13P	probably damaging	Het
Ankrd36	T	C	11: 5,607,143	S364P	possibly damaging	Het
Ap2a1	T	C	7: 44,915,938	T126A	probably benign	Het
Apob	A	G	12: 8,012,365	I3616V	probably benign	Het
Arl5a	A	T	2: 52,416,202	N39K	probably benign	Het
Baiap2	G	A	11: 119,997,540	R334H	probably damaging	Het
Bbox1	T	A	2: 110,292,548	N132I	possibly damaging	Het
Bcl11b	A	G	12: 107,916,649	L469P	probably damaging	Het
Brca1	A	G	11: 101,525,565	I581T	probably damaging	Het
Cacng2	T	C	15: 78,118,797	Y32C	probably damaging	Het
Capn9	G	T	8: 124,611,565		probably null	Het
Cdh18	A	G	15: 23,400,585	T290A	probably benign	Het
Cdk5rap2	C	T	4: 70,302,150	V593I	possibly damaging	Het
Cep128	G	C	12: 91,230,822	D91E	probably damaging	Het
Cep295	T	C	9: 15,333,921	M1080V	probably benign	Het
Coq8b	T	A	7: 27,240,124	M193K	probably benign	Het
Csn1s2b	A	G	5: 87,822,303	Y131C	probably damaging	Het
D130043K22Rik	T	C	13: 24,882,556	S779P	probably damaging	Het
Dgat1	C	T	15: 76,503,019	C356Y	probably benign	Het
Dnah12	A	T	14: 26,778,883	T1543S	possibly damaging	Het
Dock3	T	C	9: 106,973,841	S821G	probably damaging	Het
Dock4	G	A	12: 40,725,780	C574Y	probably damaging	Het
Dr1	T	C	5: 108,269,738	I50T	probably damaging	Het
Dzip3	A	T	16: 48,958,417		probably null	Het
Eln	C	A	5: 134,703,782	*861L	probably null	Het
Eml6	T	A	11: 29,759,065	H24L	probably benign	Het
Eps8l3	A	C	3: 107,891,306	T503P	possibly damaging	Het
Fam69c	A	T	18: 84,736,863	I155F	possibly damaging	Het
Fgf1	C	A	18: 38,841,932	D155Y	possibly damaging	Het
Fkbp15	A	T	4: 62,324,194	M507K	probably damaging	Het
Flnb	A	T	14: 7,913,121	R1463S	probably benign	Het
Fras1	C	T	5: 96,645,873	T1018I	probably benign	Het
Gm10803	T	A	2: 93,564,188	C102S	probably damaging	Het
Gpatch1	C	A	7: 35,303,387	V233L	possibly damaging	Het
Gramd1a	T	C	7: 31,142,900		probably null	Het
Gsk3a	T	C	7: 25,235,708	T106A	possibly damaging	Het
Hap1	A	G	11: 100,349,476	V136A	possibly damaging	Het
Helq	A	T	5: 100,792,813	S307T	probably benign	Het
Herc2	T	A	7: 56,088,400	S264T	possibly damaging	Het
Htr4	A	G	18: 62,428,066	M133V	possibly damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Jakmip2	A	G	18: 43,581,831		probably null	Het
Ldhd	T	A	8: 111,628,113	S358C	possibly damaging	Het
Lrp1	A	T	10: 127,574,332	V1515E	probably damaging	Het
Ltbp3	A	G	19: 5,751,754	D700G	probably benign	Het
Magel2	T	G	7: 62,380,235	S962R	unknown	Het
Map2	A	C	1: 66,415,622		probably null	Het
Map3k1	T	A	13: 111,757,150	E704V	probably damaging	Het
Mrpl39	A	T	16: 84,730,459	V180D	probably damaging	Het
Myef2	T	C	2: 125,098,058	M383V	probably damaging	Het
Myh3	A	G	11: 67,089,065	Y610C	probably damaging	Het
Olfr1328	A	G	4: 118,934,581	L89P	probably damaging	Het
Olfr555	T	C	7: 102,659,697	V292A	probably damaging	Het
Olfr969	T	A	9: 39,795,658	Y94*	probably null	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pabpc1	T	A	15: 36,605,541	N135I	possibly damaging	Het
Pcsk6	T	A	7: 65,910,228	H100Q	probably damaging	Het
Pdss1	A	G	2: 22,915,519	K270E	probably damaging	Het
Pigx	A	T	16: 32,087,450	S18T	possibly damaging	Het
Plbd2	T	A	5: 120,485,784	T558S	probably damaging	Het
Plppr1	A	T	4: 49,325,617		probably null	Het
Plppr2	T	A	9: 21,944,421	V230E	possibly damaging	Het
Pola2	A	G	19: 5,953,063		probably null	Het
Ppp2r3a	A	G	9: 101,212,306	S273P	probably benign	Het
Prkdc	A	G	16: 15,676,989	E741G	probably benign	Het
Prom2	C	A	2: 127,540,162	V111L	possibly damaging	Het
Rapgef4	A	G	2: 72,226,568	D557G	possibly damaging	Het
Rgs10	T	C	7: 128,373,970	T158A	probably benign	Het
Rnf123	A	C	9: 108,077,398	Y40D	probably benign	Het
Rnf14	A	G	18: 38,308,189	T211A	probably benign	Het
Rp1l1	T	A	14: 64,028,968	S668T	probably damaging	Het
Sema6d	T	A	2: 124,665,149	L946Q	probably benign	Het
Sgcd	T	G	11: 47,195,042	K94Q	probably benign	Het
Skor2	A	T	18: 76,859,516	D311V	unknown	Het
Slc17a2	A	T	13: 23,812,640	I43F	probably damaging	Het
Spdye4c	C	A	2: 128,592,622	P40T	probably damaging	Het
Srp72	C	A	5: 76,987,870	Q216K	possibly damaging	Het
Tmem62	C	T	2: 121,007,057	T485I	probably benign	Het
Tmem94	G	T	11: 115,790,230	V432L	probably damaging	Het
Trio	T	C	15: 27,744,146		probably null	Het
Uggt2	A	T	14: 119,054,643	D581E	probably benign	Het
Unc5d	T	A	8: 28,759,081	S319C	probably damaging	Het
Vmn1r211	T	C	13: 22,851,643	I285V	probably damaging	Het
Vmn2r99	A	C	17: 19,377,945	N77T	probably damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGACATGGCTTTAGACCATGCGATTC -3'
(R):5'- CATTTCAGATGGAACTGGATAGGAGCG -3'

Sequencing Primer
(F):5'- GACCATGCGATTCTATTAAAGATCCC -3'
(R):5'- TCCTAACTGAGCATAGCATGG -3'

Posted On

2014-05-14