Incidental Mutation 'R1682:Rnf123'
ID 189255
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 039718-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R1682 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108077398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 40 (Y40D)
Ref Sequence ENSEMBL: ENSMUSP00000125213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: Y40D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Y40D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: Y40D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Y40D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: Y40D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Y40D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000161828
AA Change: Y40D

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162152
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: Y40D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Y40D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
AA Change: Y40D

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
AA Change: Y40D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: Y40D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Y40D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 (GRCm38) D2203G probably benign Het
Acin1 A G 14: 54,663,718 (GRCm38) S629P probably damaging Het
Agbl2 T A 2: 90,784,090 (GRCm38) I22N probably benign Het
Ank1 A G 8: 23,109,327 (GRCm38) E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 (GRCm38) L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 (GRCm38) S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 (GRCm38) T126A probably benign Het
Apob A G 12: 8,012,365 (GRCm38) I3616V probably benign Het
Arl5a A T 2: 52,416,202 (GRCm38) N39K probably benign Het
Baiap2 G A 11: 119,997,540 (GRCm38) R334H probably damaging Het
Bbox1 T A 2: 110,292,548 (GRCm38) N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 (GRCm38) L469P probably damaging Het
Brca1 A G 11: 101,525,565 (GRCm38) I581T probably damaging Het
Cacng2 T C 15: 78,118,797 (GRCm38) Y32C probably damaging Het
Capn9 G T 8: 124,611,565 (GRCm38) probably null Het
Cdh18 A G 15: 23,400,585 (GRCm38) T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 (GRCm38) V593I possibly damaging Het
Cep128 G C 12: 91,230,822 (GRCm38) D91E probably damaging Het
Cep295 T C 9: 15,333,921 (GRCm38) M1080V probably benign Het
Coq8b T A 7: 27,240,124 (GRCm38) M193K probably benign Het
Csn1s2b A G 5: 87,822,303 (GRCm38) Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 (GRCm38) S779P probably damaging Het
Dgat1 C T 15: 76,503,019 (GRCm38) C356Y probably benign Het
Dipk1c A T 18: 84,736,863 (GRCm38) I155F possibly damaging Het
Dnah12 A T 14: 26,778,883 (GRCm38) T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 (GRCm38) S821G probably damaging Het
Dock4 G A 12: 40,725,780 (GRCm38) C574Y probably damaging Het
Dr1 T C 5: 108,269,738 (GRCm38) I50T probably damaging Het
Dzip3 A T 16: 48,958,417 (GRCm38) probably null Het
Eln C A 5: 134,703,782 (GRCm38) *861L probably null Het
Eml6 T A 11: 29,759,065 (GRCm38) H24L probably benign Het
Eps8l3 A C 3: 107,891,306 (GRCm38) T503P possibly damaging Het
Fgf1 C A 18: 38,841,932 (GRCm38) D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 (GRCm38) M507K probably damaging Het
Flnb A T 14: 7,913,121 (GRCm38) R1463S probably benign Het
Fras1 C T 5: 96,645,873 (GRCm38) T1018I probably benign Het
Gm10803 T A 2: 93,564,188 (GRCm38) C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 (GRCm38) V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 (GRCm38) probably null Het
Gsk3a T C 7: 25,235,708 (GRCm38) T106A possibly damaging Het
Hap1 A G 11: 100,349,476 (GRCm38) V136A possibly damaging Het
Helq A T 5: 100,792,813 (GRCm38) S307T probably benign Het
Herc2 T A 7: 56,088,400 (GRCm38) S264T possibly damaging Het
Htr4 A G 18: 62,428,066 (GRCm38) M133V possibly damaging Het
Iqca1 C A 1: 90,142,731 (GRCm38) G133V probably null Het
Jakmip2 A G 18: 43,581,831 (GRCm38) probably null Het
Ldhd T A 8: 111,628,113 (GRCm38) S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 (GRCm38) V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 (GRCm38) D700G probably benign Het
Magel2 T G 7: 62,380,235 (GRCm38) S962R unknown Het
Map2 A C 1: 66,415,622 (GRCm38) probably null Het
Map3k1 T A 13: 111,757,150 (GRCm38) E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 (GRCm38) V180D probably damaging Het
Myef2 T C 2: 125,098,058 (GRCm38) M383V probably damaging Het
Myh3 A G 11: 67,089,065 (GRCm38) Y610C probably damaging Het
Or10ak7 A G 4: 118,934,581 (GRCm38) L89P probably damaging Het
Or51h1 T C 7: 102,659,697 (GRCm38) V292A probably damaging Het
Or8g54 T A 9: 39,795,658 (GRCm38) Y94* probably null Het
Oxtr C T 6: 112,477,177 (GRCm38) R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 (GRCm38) N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 (GRCm38) H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 (GRCm38) K270E probably damaging Het
Pigx A T 16: 32,087,450 (GRCm38) S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 (GRCm38) T558S probably damaging Het
Plppr1 A T 4: 49,325,617 (GRCm38) probably null Het
Plppr2 T A 9: 21,944,421 (GRCm38) V230E possibly damaging Het
Pola2 A G 19: 5,953,063 (GRCm38) probably null Het
Ppp2r3a A G 9: 101,212,306 (GRCm38) S273P probably benign Het
Prkdc A G 16: 15,676,989 (GRCm38) E741G probably benign Het
Prom2 C A 2: 127,540,162 (GRCm38) V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 (GRCm38) D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 (GRCm38) T158A probably benign Het
Rnf14 A G 18: 38,308,189 (GRCm38) T211A probably benign Het
Rp1l1 T A 14: 64,028,968 (GRCm38) S668T probably damaging Het
Sema6d T A 2: 124,665,149 (GRCm38) L946Q probably benign Het
Sgcd T G 11: 47,195,042 (GRCm38) K94Q probably benign Het
Skor2 A T 18: 76,859,516 (GRCm38) D311V unknown Het
Slc17a2 A T 13: 23,812,640 (GRCm38) I43F probably damaging Het
Spdye4c C A 2: 128,592,622 (GRCm38) P40T probably damaging Het
Srp72 C A 5: 76,987,870 (GRCm38) Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 (GRCm38) T485I probably benign Het
Tmem94 G T 11: 115,790,230 (GRCm38) V432L probably damaging Het
Trio T C 15: 27,744,146 (GRCm38) probably null Het
Uggt2 A T 14: 119,054,643 (GRCm38) D581E probably benign Het
Unc5d T A 8: 28,759,081 (GRCm38) S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 (GRCm38) I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 (GRCm38) Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 (GRCm38) N77T probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108,067,395 (GRCm38) critical splice donor site probably null
IGL01358:Rnf123 APN 9 108,069,182 (GRCm38) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108,052,302 (GRCm38) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108,058,238 (GRCm38) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108,058,356 (GRCm38) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108,071,370 (GRCm38) splice site probably benign
IGL02070:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02072:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02073:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02074:Rnf123 APN 9 108,066,889 (GRCm38) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02080:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02231:Rnf123 APN 9 108,066,399 (GRCm38) missense probably benign 0.17
IGL02281:Rnf123 APN 9 108,071,452 (GRCm38) missense probably benign 0.01
IGL02336:Rnf123 APN 9 108,061,842 (GRCm38) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108,066,348 (GRCm38) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108,052,212 (GRCm38) critical splice donor site probably null
IGL02571:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02572:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02574:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02586:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02589:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02600:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02601:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02602:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02603:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02609:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02628:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02629:Rnf123 APN 9 108,070,789 (GRCm38) splice site probably benign
IGL02629:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02630:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02631:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02632:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02650:Rnf123 APN 9 108,069,748 (GRCm38) missense probably benign 0.29
IGL02690:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02691:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02692:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02693:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02713:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02736:Rnf123 APN 9 108,068,302 (GRCm38) nonsense probably null
IGL02929:Rnf123 APN 9 108,069,076 (GRCm38) missense probably benign
R1175:Rnf123 UTSW 9 108,077,373 (GRCm38) missense probably benign
R1465:Rnf123 UTSW 9 108,071,466 (GRCm38) splice site probably benign
R1502:Rnf123 UTSW 9 108,068,510 (GRCm38) splice site probably null
R1817:Rnf123 UTSW 9 108,062,926 (GRCm38) missense probably benign 0.41
R1855:Rnf123 UTSW 9 108,061,791 (GRCm38) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108,063,536 (GRCm38) missense probably benign 0.00
R2483:Rnf123 UTSW 9 108,063,521 (GRCm38) missense probably benign 0.16
R3896:Rnf123 UTSW 9 108,069,103 (GRCm38) splice site probably benign
R3940:Rnf123 UTSW 9 108,064,035 (GRCm38) splice site probably benign
R4206:Rnf123 UTSW 9 108,063,963 (GRCm38) missense probably benign 0.01
R4641:Rnf123 UTSW 9 108,058,587 (GRCm38) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108,052,439 (GRCm38) splice site probably null
R4767:Rnf123 UTSW 9 108,052,089 (GRCm38) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108,056,091 (GRCm38) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108,063,680 (GRCm38) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108,064,003 (GRCm38) frame shift probably null
R5275:Rnf123 UTSW 9 108,064,003 (GRCm38) frame shift probably null
R5276:Rnf123 UTSW 9 108,064,003 (GRCm38) frame shift probably null
R5294:Rnf123 UTSW 9 108,064,003 (GRCm38) frame shift probably null
R5295:Rnf123 UTSW 9 108,064,003 (GRCm38) frame shift probably null
R5394:Rnf123 UTSW 9 108,070,731 (GRCm38) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108,067,424 (GRCm38) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108,069,958 (GRCm38) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108,056,053 (GRCm38) missense probably benign 0.17
R6502:Rnf123 UTSW 9 108,068,332 (GRCm38) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108,063,623 (GRCm38) missense probably benign 0.02
R7003:Rnf123 UTSW 9 108,063,683 (GRCm38) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108,058,536 (GRCm38) missense probably null 1.00
R7092:Rnf123 UTSW 9 108,068,600 (GRCm38) missense probably benign 0.07
R7100:Rnf123 UTSW 9 108,056,639 (GRCm38) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108,069,029 (GRCm38) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108,070,408 (GRCm38) splice site probably null
R7468:Rnf123 UTSW 9 108,069,009 (GRCm38) missense probably benign 0.00
R7517:Rnf123 UTSW 9 108,070,274 (GRCm38) nonsense probably null
R7577:Rnf123 UTSW 9 108,070,619 (GRCm38) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108,062,890 (GRCm38) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108,068,507 (GRCm38) missense probably benign 0.26
R8754:Rnf123 UTSW 9 108,071,164 (GRCm38) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108,069,073 (GRCm38) missense probably benign
R9052:Rnf123 UTSW 9 108,059,731 (GRCm38) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108,063,028 (GRCm38) splice site probably benign
R9170:Rnf123 UTSW 9 108,071,176 (GRCm38) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108,067,505 (GRCm38) missense probably benign 0.00
R9385:Rnf123 UTSW 9 108,052,268 (GRCm38) missense probably benign 0.02
R9394:Rnf123 UTSW 9 108,065,706 (GRCm38) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108,059,809 (GRCm38) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108,077,764 (GRCm38) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108,062,981 (GRCm38) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108,058,395 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCTGGAAAAGAGCTACTGCTG -3'
(R):5'- TGCTGACACCCATAGAAAAGTGCG -3'

Sequencing Primer
(F):5'- AAAGAGCTACTGCTGTCTGG -3'
(R):5'- CGCTCAGTGTGGTTGCTC -3'
Posted On 2014-05-14