Incidental Mutation 'R1682:Acaca'
ID189263
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission 039718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1682 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84392217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2203 (D2203G)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably benign
Transcript: ENSMUST00000020843
AA Change: D2203G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: D2203G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103201
AA Change: D2203G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: D2203G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dnah12 A T 14: 26,778,883 T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eln C A 5: 134,703,782 *861L probably null Het
Eml6 T A 11: 29,759,065 H24L probably benign Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Prom2 C A 2: 127,540,162 V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Slc17a2 A T 13: 23,812,640 I43F probably damaging Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACATCAATCCAGGTGATCCCCAG -3'
(R):5'- TGCCTTCAACTTCTACAAACCAGCG -3'

Sequencing Primer
(F):5'- CCAGACTGTGGAGTACTACAATGTC -3'
(R):5'- AGCGTCTCAACATGGCCTG -3'
Posted On2014-05-14