Incidental Mutation 'R1682:Dock4'
ID 189269
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 039718-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R1682 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40775779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 574 (C574Y)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably damaging
Transcript: ENSMUST00000037488
AA Change: C574Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: C574Y

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: C574Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,283,043 (GRCm39) D2203G probably benign Het
Acin1 A G 14: 54,901,175 (GRCm39) S629P probably damaging Het
Agbl2 T A 2: 90,614,434 (GRCm39) I22N probably benign Het
Ank1 A G 8: 23,599,343 (GRCm39) E796G probably damaging Het
Ankrd13d A G 19: 4,332,961 (GRCm39) L13P probably damaging Het
Ankrd36 T C 11: 5,557,143 (GRCm39) S364P possibly damaging Het
Ap2a1 T C 7: 44,565,362 (GRCm39) T126A probably benign Het
Apob A G 12: 8,062,365 (GRCm39) I3616V probably benign Het
Arl5a A T 2: 52,306,214 (GRCm39) N39K probably benign Het
Baiap2 G A 11: 119,888,366 (GRCm39) R334H probably damaging Het
Bbox1 T A 2: 110,122,893 (GRCm39) N132I possibly damaging Het
Bcl11b A G 12: 107,882,908 (GRCm39) L469P probably damaging Het
Brca1 A G 11: 101,416,391 (GRCm39) I581T probably damaging Het
Cacng2 T C 15: 78,002,997 (GRCm39) Y32C probably damaging Het
Capn9 G T 8: 125,338,304 (GRCm39) probably null Het
Cdh18 A G 15: 23,400,671 (GRCm39) T290A probably benign Het
Cdk5rap2 C T 4: 70,220,387 (GRCm39) V593I possibly damaging Het
Cep128 G C 12: 91,197,596 (GRCm39) D91E probably damaging Het
Cep295 T C 9: 15,245,217 (GRCm39) M1080V probably benign Het
Coq8b T A 7: 26,939,549 (GRCm39) M193K probably benign Het
Csn1s2b A G 5: 87,970,162 (GRCm39) Y131C probably damaging Het
D130043K22Rik T C 13: 25,066,539 (GRCm39) S779P probably damaging Het
Dgat1 C T 15: 76,387,219 (GRCm39) C356Y probably benign Het
Dipk1c A T 18: 84,754,988 (GRCm39) I155F possibly damaging Het
Dnah12 A T 14: 26,500,840 (GRCm39) T1543S possibly damaging Het
Dock3 T C 9: 106,851,040 (GRCm39) S821G probably damaging Het
Dr1 T C 5: 108,417,604 (GRCm39) I50T probably damaging Het
Dzip3 A T 16: 48,778,780 (GRCm39) probably null Het
Eln C A 5: 134,732,636 (GRCm39) *861L probably null Het
Eml6 T A 11: 29,709,065 (GRCm39) H24L probably benign Het
Eps8l3 A C 3: 107,798,622 (GRCm39) T503P possibly damaging Het
Fgf1 C A 18: 38,974,985 (GRCm39) D155Y possibly damaging Het
Fkbp15 A T 4: 62,242,431 (GRCm39) M507K probably damaging Het
Flnb A T 14: 7,913,121 (GRCm38) R1463S probably benign Het
Fras1 C T 5: 96,793,732 (GRCm39) T1018I probably benign Het
Gm10803 T A 2: 93,394,533 (GRCm39) C102S probably damaging Het
Gpatch1 C A 7: 35,002,812 (GRCm39) V233L possibly damaging Het
Gramd1a T C 7: 30,842,325 (GRCm39) probably null Het
Gsk3a T C 7: 24,935,133 (GRCm39) T106A possibly damaging Het
Hap1 A G 11: 100,240,302 (GRCm39) V136A possibly damaging Het
Helq A T 5: 100,940,679 (GRCm39) S307T probably benign Het
Herc2 T A 7: 55,738,148 (GRCm39) S264T possibly damaging Het
Htr4 A G 18: 62,561,137 (GRCm39) M133V possibly damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Jakmip2 A G 18: 43,714,896 (GRCm39) probably null Het
Ldhd T A 8: 112,354,745 (GRCm39) S358C possibly damaging Het
Lrp1 A T 10: 127,410,201 (GRCm39) V1515E probably damaging Het
Ltbp3 A G 19: 5,801,782 (GRCm39) D700G probably benign Het
Magel2 T G 7: 62,029,983 (GRCm39) S962R unknown Het
Map2 A C 1: 66,454,781 (GRCm39) probably null Het
Map3k1 T A 13: 111,893,684 (GRCm39) E704V probably damaging Het
Mrpl39 A T 16: 84,527,347 (GRCm39) V180D probably damaging Het
Myef2 T C 2: 124,939,978 (GRCm39) M383V probably damaging Het
Myh3 A G 11: 66,979,891 (GRCm39) Y610C probably damaging Het
Or10ak7 A G 4: 118,791,778 (GRCm39) L89P probably damaging Het
Or51h1 T C 7: 102,308,904 (GRCm39) V292A probably damaging Het
Or8g54 T A 9: 39,706,954 (GRCm39) Y94* probably null Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pabpc1 T A 15: 36,605,785 (GRCm39) N135I possibly damaging Het
Pcsk6 T A 7: 65,559,976 (GRCm39) H100Q probably damaging Het
Pdss1 A G 2: 22,805,531 (GRCm39) K270E probably damaging Het
Pigx A T 16: 31,906,268 (GRCm39) S18T possibly damaging Het
Plbd2 T A 5: 120,623,849 (GRCm39) T558S probably damaging Het
Plppr1 A T 4: 49,325,617 (GRCm39) probably null Het
Plppr2 T A 9: 21,855,717 (GRCm39) V230E possibly damaging Het
Pola2 A G 19: 6,003,091 (GRCm39) probably null Het
Ppp2r3d A G 9: 101,089,505 (GRCm39) S273P probably benign Het
Prkdc A G 16: 15,494,853 (GRCm39) E741G probably benign Het
Prom2 C A 2: 127,382,082 (GRCm39) V111L possibly damaging Het
Rapgef4 A G 2: 72,056,912 (GRCm39) D557G possibly damaging Het
Rgs10 T C 7: 127,975,694 (GRCm39) T158A probably benign Het
Rnf123 A C 9: 107,954,597 (GRCm39) Y40D probably benign Het
Rnf14 A G 18: 38,441,242 (GRCm39) T211A probably benign Het
Rp1l1 T A 14: 64,266,417 (GRCm39) S668T probably damaging Het
Sema6d T A 2: 124,507,069 (GRCm39) L946Q probably benign Het
Sgcd T G 11: 47,085,869 (GRCm39) K94Q probably benign Het
Skor2 A T 18: 76,947,211 (GRCm39) D311V unknown Het
Slc34a1 A T 13: 23,996,623 (GRCm39) I43F probably damaging Het
Spdye4c C A 2: 128,434,542 (GRCm39) P40T probably damaging Het
Srp72 C A 5: 77,135,717 (GRCm39) Q216K possibly damaging Het
Tmem62 C T 2: 120,837,538 (GRCm39) T485I probably benign Het
Tmem94 G T 11: 115,681,056 (GRCm39) V432L probably damaging Het
Trio T C 15: 27,744,232 (GRCm39) probably null Het
Uggt2 A T 14: 119,292,055 (GRCm39) D581E probably benign Het
Unc5d T A 8: 29,249,109 (GRCm39) S319C probably damaging Het
Vmn1r211 T C 13: 23,035,813 (GRCm39) I285V probably damaging Het
Vmn2r68 A G 7: 84,882,574 (GRCm39) Y393H possibly damaging Het
Vmn2r99 A C 17: 19,598,207 (GRCm39) N77T probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTTCATTCACACTGGGAGTAACAGAG -3'
(R):5'- GCCTGCAATTAGCACCGCTTATG -3'

Sequencing Primer
(F):5'- GGACTTTCCTTAAAAGCCAAATTCTG -3'
(R):5'- GGTTTCAACACTGGGCTAATTC -3'
Posted On 2014-05-14