Incidental Mutation 'R1682:Uggt2'
ID 189281
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene Name UDP-glucose glycoprotein glucosyltransferase 2
Synonyms 3110001A05Rik, A230065J02Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2
MMRRC Submission 039718-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R1682 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 119222451-119336842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119292055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 581 (D581E)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
AlphaFold E9Q4X2
Predicted Effect probably benign
Transcript: ENSMUST00000127153
AA Change: D105E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104
AA Change: D105E

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138923
Predicted Effect probably benign
Transcript: ENSMUST00000156203
AA Change: D581E

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: D581E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,283,043 (GRCm39) D2203G probably benign Het
Acin1 A G 14: 54,901,175 (GRCm39) S629P probably damaging Het
Agbl2 T A 2: 90,614,434 (GRCm39) I22N probably benign Het
Ank1 A G 8: 23,599,343 (GRCm39) E796G probably damaging Het
Ankrd13d A G 19: 4,332,961 (GRCm39) L13P probably damaging Het
Ankrd36 T C 11: 5,557,143 (GRCm39) S364P possibly damaging Het
Ap2a1 T C 7: 44,565,362 (GRCm39) T126A probably benign Het
Apob A G 12: 8,062,365 (GRCm39) I3616V probably benign Het
Arl5a A T 2: 52,306,214 (GRCm39) N39K probably benign Het
Baiap2 G A 11: 119,888,366 (GRCm39) R334H probably damaging Het
Bbox1 T A 2: 110,122,893 (GRCm39) N132I possibly damaging Het
Bcl11b A G 12: 107,882,908 (GRCm39) L469P probably damaging Het
Brca1 A G 11: 101,416,391 (GRCm39) I581T probably damaging Het
Cacng2 T C 15: 78,002,997 (GRCm39) Y32C probably damaging Het
Capn9 G T 8: 125,338,304 (GRCm39) probably null Het
Cdh18 A G 15: 23,400,671 (GRCm39) T290A probably benign Het
Cdk5rap2 C T 4: 70,220,387 (GRCm39) V593I possibly damaging Het
Cep128 G C 12: 91,197,596 (GRCm39) D91E probably damaging Het
Cep295 T C 9: 15,245,217 (GRCm39) M1080V probably benign Het
Coq8b T A 7: 26,939,549 (GRCm39) M193K probably benign Het
Csn1s2b A G 5: 87,970,162 (GRCm39) Y131C probably damaging Het
D130043K22Rik T C 13: 25,066,539 (GRCm39) S779P probably damaging Het
Dgat1 C T 15: 76,387,219 (GRCm39) C356Y probably benign Het
Dipk1c A T 18: 84,754,988 (GRCm39) I155F possibly damaging Het
Dnah12 A T 14: 26,500,840 (GRCm39) T1543S possibly damaging Het
Dock3 T C 9: 106,851,040 (GRCm39) S821G probably damaging Het
Dock4 G A 12: 40,775,779 (GRCm39) C574Y probably damaging Het
Dr1 T C 5: 108,417,604 (GRCm39) I50T probably damaging Het
Dzip3 A T 16: 48,778,780 (GRCm39) probably null Het
Eln C A 5: 134,732,636 (GRCm39) *861L probably null Het
Eml6 T A 11: 29,709,065 (GRCm39) H24L probably benign Het
Eps8l3 A C 3: 107,798,622 (GRCm39) T503P possibly damaging Het
Fgf1 C A 18: 38,974,985 (GRCm39) D155Y possibly damaging Het
Fkbp15 A T 4: 62,242,431 (GRCm39) M507K probably damaging Het
Flnb A T 14: 7,913,121 (GRCm38) R1463S probably benign Het
Fras1 C T 5: 96,793,732 (GRCm39) T1018I probably benign Het
Gm10803 T A 2: 93,394,533 (GRCm39) C102S probably damaging Het
Gpatch1 C A 7: 35,002,812 (GRCm39) V233L possibly damaging Het
Gramd1a T C 7: 30,842,325 (GRCm39) probably null Het
Gsk3a T C 7: 24,935,133 (GRCm39) T106A possibly damaging Het
Hap1 A G 11: 100,240,302 (GRCm39) V136A possibly damaging Het
Helq A T 5: 100,940,679 (GRCm39) S307T probably benign Het
Herc2 T A 7: 55,738,148 (GRCm39) S264T possibly damaging Het
Htr4 A G 18: 62,561,137 (GRCm39) M133V possibly damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Jakmip2 A G 18: 43,714,896 (GRCm39) probably null Het
Ldhd T A 8: 112,354,745 (GRCm39) S358C possibly damaging Het
Lrp1 A T 10: 127,410,201 (GRCm39) V1515E probably damaging Het
Ltbp3 A G 19: 5,801,782 (GRCm39) D700G probably benign Het
Magel2 T G 7: 62,029,983 (GRCm39) S962R unknown Het
Map2 A C 1: 66,454,781 (GRCm39) probably null Het
Map3k1 T A 13: 111,893,684 (GRCm39) E704V probably damaging Het
Mrpl39 A T 16: 84,527,347 (GRCm39) V180D probably damaging Het
Myef2 T C 2: 124,939,978 (GRCm39) M383V probably damaging Het
Myh3 A G 11: 66,979,891 (GRCm39) Y610C probably damaging Het
Or10ak7 A G 4: 118,791,778 (GRCm39) L89P probably damaging Het
Or51h1 T C 7: 102,308,904 (GRCm39) V292A probably damaging Het
Or8g54 T A 9: 39,706,954 (GRCm39) Y94* probably null Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pabpc1 T A 15: 36,605,785 (GRCm39) N135I possibly damaging Het
Pcsk6 T A 7: 65,559,976 (GRCm39) H100Q probably damaging Het
Pdss1 A G 2: 22,805,531 (GRCm39) K270E probably damaging Het
Pigx A T 16: 31,906,268 (GRCm39) S18T possibly damaging Het
Plbd2 T A 5: 120,623,849 (GRCm39) T558S probably damaging Het
Plppr1 A T 4: 49,325,617 (GRCm39) probably null Het
Plppr2 T A 9: 21,855,717 (GRCm39) V230E possibly damaging Het
Pola2 A G 19: 6,003,091 (GRCm39) probably null Het
Ppp2r3d A G 9: 101,089,505 (GRCm39) S273P probably benign Het
Prkdc A G 16: 15,494,853 (GRCm39) E741G probably benign Het
Prom2 C A 2: 127,382,082 (GRCm39) V111L possibly damaging Het
Rapgef4 A G 2: 72,056,912 (GRCm39) D557G possibly damaging Het
Rgs10 T C 7: 127,975,694 (GRCm39) T158A probably benign Het
Rnf123 A C 9: 107,954,597 (GRCm39) Y40D probably benign Het
Rnf14 A G 18: 38,441,242 (GRCm39) T211A probably benign Het
Rp1l1 T A 14: 64,266,417 (GRCm39) S668T probably damaging Het
Sema6d T A 2: 124,507,069 (GRCm39) L946Q probably benign Het
Sgcd T G 11: 47,085,869 (GRCm39) K94Q probably benign Het
Skor2 A T 18: 76,947,211 (GRCm39) D311V unknown Het
Slc34a1 A T 13: 23,996,623 (GRCm39) I43F probably damaging Het
Spdye4c C A 2: 128,434,542 (GRCm39) P40T probably damaging Het
Srp72 C A 5: 77,135,717 (GRCm39) Q216K possibly damaging Het
Tmem62 C T 2: 120,837,538 (GRCm39) T485I probably benign Het
Tmem94 G T 11: 115,681,056 (GRCm39) V432L probably damaging Het
Trio T C 15: 27,744,232 (GRCm39) probably null Het
Unc5d T A 8: 29,249,109 (GRCm39) S319C probably damaging Het
Vmn1r211 T C 13: 23,035,813 (GRCm39) I285V probably damaging Het
Vmn2r68 A G 7: 84,882,574 (GRCm39) Y393H possibly damaging Het
Vmn2r99 A C 17: 19,598,207 (GRCm39) N77T probably damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119,286,688 (GRCm39) missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119,263,841 (GRCm39) nonsense probably null
IGL00433:Uggt2 APN 14 119,250,899 (GRCm39) missense probably benign
IGL00572:Uggt2 APN 14 119,280,203 (GRCm39) missense probably benign 0.02
IGL00577:Uggt2 APN 14 119,272,312 (GRCm39) missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119,280,211 (GRCm39) missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119,295,057 (GRCm39) missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119,280,184 (GRCm39) missense probably benign 0.00
IGL01787:Uggt2 APN 14 119,319,146 (GRCm39) missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119,326,605 (GRCm39) missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119,328,150 (GRCm39) missense probably benign 0.17
IGL02894:Uggt2 APN 14 119,319,211 (GRCm39) missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119,312,758 (GRCm39) missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119,332,722 (GRCm39) missense probably benign 0.25
IGL03142:Uggt2 APN 14 119,235,603 (GRCm39) missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119,315,080 (GRCm39) missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119,308,300 (GRCm39) missense probably benign 0.38
P0014:Uggt2 UTSW 14 119,281,950 (GRCm39) missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119,287,075 (GRCm39) missense probably benign 0.07
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0383:Uggt2 UTSW 14 119,286,863 (GRCm39) missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R0472:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119,295,010 (GRCm39) missense probably benign 0.27
R0788:Uggt2 UTSW 14 119,332,812 (GRCm39) splice site probably benign
R0940:Uggt2 UTSW 14 119,328,604 (GRCm39) critical splice donor site probably null
R1567:Uggt2 UTSW 14 119,246,505 (GRCm39) missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119,295,075 (GRCm39) missense possibly damaging 0.95
R1746:Uggt2 UTSW 14 119,250,915 (GRCm39) missense probably benign 0.00
R1785:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119,269,688 (GRCm39) missense probably benign 0.00
R1894:Uggt2 UTSW 14 119,287,130 (GRCm39) missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119,245,467 (GRCm39) splice site probably benign
R2149:Uggt2 UTSW 14 119,312,757 (GRCm39) missense probably benign 0.02
R2168:Uggt2 UTSW 14 119,256,917 (GRCm39) missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2240:Uggt2 UTSW 14 119,232,461 (GRCm39) missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119,264,011 (GRCm39) missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119,296,521 (GRCm39) missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2907:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2908:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2998:Uggt2 UTSW 14 119,286,797 (GRCm39) missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119,328,682 (GRCm39) missense probably benign 0.39
R3722:Uggt2 UTSW 14 119,278,930 (GRCm39) missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119,295,084 (GRCm39) missense probably benign 0.13
R4015:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119,286,674 (GRCm39) missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119,256,970 (GRCm39) missense probably benign
R4642:Uggt2 UTSW 14 119,272,347 (GRCm39) missense probably benign 0.00
R4654:Uggt2 UTSW 14 119,269,670 (GRCm39) missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119,266,466 (GRCm39) splice site probably null
R4810:Uggt2 UTSW 14 119,250,933 (GRCm39) missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119,239,259 (GRCm39) missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4886:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4888:Uggt2 UTSW 14 119,315,062 (GRCm39) critical splice donor site probably null
R4888:Uggt2 UTSW 14 119,286,665 (GRCm39) missense probably damaging 1.00
R4895:Uggt2 UTSW 14 119,256,298 (GRCm39) missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119,319,182 (GRCm39) missense probably benign 0.00
R5423:Uggt2 UTSW 14 119,256,898 (GRCm39) missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119,328,121 (GRCm39) missense probably benign 0.01
R5561:Uggt2 UTSW 14 119,278,939 (GRCm39) missense probably benign 0.02
R5607:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119,315,136 (GRCm39) missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119,280,138 (GRCm39) missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119,286,838 (GRCm39) missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6056:Uggt2 UTSW 14 119,273,381 (GRCm39) critical splice donor site probably null
R6289:Uggt2 UTSW 14 119,279,014 (GRCm39) missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119,294,976 (GRCm39) missense probably benign 0.01
R6515:Uggt2 UTSW 14 119,315,131 (GRCm39) missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119,308,293 (GRCm39) missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119,280,022 (GRCm39) missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119,263,847 (GRCm39) missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119,239,271 (GRCm39) missense probably benign 0.10
R7117:Uggt2 UTSW 14 119,251,938 (GRCm39) missense probably benign 0.25
R7183:Uggt2 UTSW 14 119,257,049 (GRCm39) splice site probably null
R7337:Uggt2 UTSW 14 119,323,587 (GRCm39) missense probably benign 0.28
R7342:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119,326,681 (GRCm39) missense probably benign 0.12
R7625:Uggt2 UTSW 14 119,263,905 (GRCm39) missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119,312,759 (GRCm39) missense probably damaging 1.00
R7842:Uggt2 UTSW 14 119,235,516 (GRCm39) missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119,280,059 (GRCm39) missense probably benign 0.09
R7938:Uggt2 UTSW 14 119,296,519 (GRCm39) missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119,263,834 (GRCm39) missense probably damaging 0.98
R9007:Uggt2 UTSW 14 119,326,724 (GRCm39) missense probably damaging 1.00
R9080:Uggt2 UTSW 14 119,295,017 (GRCm39) missense probably benign 0.42
R9203:Uggt2 UTSW 14 119,294,975 (GRCm39) missense probably benign 0.08
R9215:Uggt2 UTSW 14 119,279,006 (GRCm39) missense probably damaging 1.00
R9324:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R9459:Uggt2 UTSW 14 119,286,595 (GRCm39) missense probably benign 0.02
R9647:Uggt2 UTSW 14 119,256,312 (GRCm39) missense probably damaging 1.00
R9781:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
Z1177:Uggt2 UTSW 14 119,244,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCACACATCTGTAAGTTCACAGGCAT -3'
(R):5'- TGGAATACTTGCCAGACAAACATGAACC -3'

Sequencing Primer
(F):5'- tcttaaacttctggtctaactgaatg -3'
(R):5'- tgggacaatgaaaacgaaagg -3'
Posted On 2014-05-14