Mutagenetix > Incidental Mutations

Incidental Mutation 'R1682:Trio'

189283

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

039718-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1682 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

splice site (2754 bp from exon)

DNA Base Change (assembly)

T to C at 27744146 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090247
AA Change: T2567A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: T2567A

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000226644

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228084

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,392,217	D2203G	probably benign	Het
Acin1	A	G	14: 54,663,718	S629P	probably damaging	Het
Agbl2	T	A	2: 90,784,090	I22N	probably benign	Het
Ank1	A	G	8: 23,109,327	E796G	probably damaging	Het
Ankrd13d	A	G	19: 4,282,933	L13P	probably damaging	Het
Ankrd36	T	C	11: 5,607,143	S364P	possibly damaging	Het
Ap2a1	T	C	7: 44,915,938	T126A	probably benign	Het
Apob	A	G	12: 8,012,365	I3616V	probably benign	Het
Arl5a	A	T	2: 52,416,202	N39K	probably benign	Het
Baiap2	G	A	11: 119,997,540	R334H	probably damaging	Het
Bbox1	T	A	2: 110,292,548	N132I	possibly damaging	Het
Bcl11b	A	G	12: 107,916,649	L469P	probably damaging	Het
Brca1	A	G	11: 101,525,565	I581T	probably damaging	Het
Cacng2	T	C	15: 78,118,797	Y32C	probably damaging	Het
Capn9	G	T	8: 124,611,565		probably null	Het
Cdh18	A	G	15: 23,400,585	T290A	probably benign	Het
Cdk5rap2	C	T	4: 70,302,150	V593I	possibly damaging	Het
Cep128	G	C	12: 91,230,822	D91E	probably damaging	Het
Cep295	T	C	9: 15,333,921	M1080V	probably benign	Het
Coq8b	T	A	7: 27,240,124	M193K	probably benign	Het
Csn1s2b	A	G	5: 87,822,303	Y131C	probably damaging	Het
D130043K22Rik	T	C	13: 24,882,556	S779P	probably damaging	Het
Dgat1	C	T	15: 76,503,019	C356Y	probably benign	Het
Dnah12	A	T	14: 26,778,883	T1543S	possibly damaging	Het
Dock3	T	C	9: 106,973,841	S821G	probably damaging	Het
Dock4	G	A	12: 40,725,780	C574Y	probably damaging	Het
Dr1	T	C	5: 108,269,738	I50T	probably damaging	Het
Dzip3	A	T	16: 48,958,417		probably null	Het
Eln	C	A	5: 134,703,782	*861L	probably null	Het
Eml6	T	A	11: 29,759,065	H24L	probably benign	Het
Eps8l3	A	C	3: 107,891,306	T503P	possibly damaging	Het
Fam69c	A	T	18: 84,736,863	I155F	possibly damaging	Het
Fgf1	C	A	18: 38,841,932	D155Y	possibly damaging	Het
Fkbp15	A	T	4: 62,324,194	M507K	probably damaging	Het
Flnb	A	T	14: 7,913,121	R1463S	probably benign	Het
Fras1	C	T	5: 96,645,873	T1018I	probably benign	Het
Gm10803	T	A	2: 93,564,188	C102S	probably damaging	Het
Gpatch1	C	A	7: 35,303,387	V233L	possibly damaging	Het
Gramd1a	T	C	7: 31,142,900		probably null	Het
Gsk3a	T	C	7: 25,235,708	T106A	possibly damaging	Het
Hap1	A	G	11: 100,349,476	V136A	possibly damaging	Het
Helq	A	T	5: 100,792,813	S307T	probably benign	Het
Herc2	T	A	7: 56,088,400	S264T	possibly damaging	Het
Htr4	A	G	18: 62,428,066	M133V	possibly damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Jakmip2	A	G	18: 43,581,831		probably null	Het
Ldhd	T	A	8: 111,628,113	S358C	possibly damaging	Het
Lrp1	A	T	10: 127,574,332	V1515E	probably damaging	Het
Ltbp3	A	G	19: 5,751,754	D700G	probably benign	Het
Magel2	T	G	7: 62,380,235	S962R	unknown	Het
Map2	A	C	1: 66,415,622		probably null	Het
Map3k1	T	A	13: 111,757,150	E704V	probably damaging	Het
Mrpl39	A	T	16: 84,730,459	V180D	probably damaging	Het
Myef2	T	C	2: 125,098,058	M383V	probably damaging	Het
Myh3	A	G	11: 67,089,065	Y610C	probably damaging	Het
Olfr1328	A	G	4: 118,934,581	L89P	probably damaging	Het
Olfr555	T	C	7: 102,659,697	V292A	probably damaging	Het
Olfr969	T	A	9: 39,795,658	Y94*	probably null	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pabpc1	T	A	15: 36,605,541	N135I	possibly damaging	Het
Pcsk6	T	A	7: 65,910,228	H100Q	probably damaging	Het
Pdss1	A	G	2: 22,915,519	K270E	probably damaging	Het
Pigx	A	T	16: 32,087,450	S18T	possibly damaging	Het
Plbd2	T	A	5: 120,485,784	T558S	probably damaging	Het
Plppr1	A	T	4: 49,325,617		probably null	Het
Plppr2	T	A	9: 21,944,421	V230E	possibly damaging	Het
Pola2	A	G	19: 5,953,063		probably null	Het
Ppp2r3a	A	G	9: 101,212,306	S273P	probably benign	Het
Prkdc	A	G	16: 15,676,989	E741G	probably benign	Het
Prom2	C	A	2: 127,540,162	V111L	possibly damaging	Het
Rapgef4	A	G	2: 72,226,568	D557G	possibly damaging	Het
Rgs10	T	C	7: 128,373,970	T158A	probably benign	Het
Rnf123	A	C	9: 108,077,398	Y40D	probably benign	Het
Rnf14	A	G	18: 38,308,189	T211A	probably benign	Het
Rp1l1	T	A	14: 64,028,968	S668T	probably damaging	Het
Sema6d	T	A	2: 124,665,149	L946Q	probably benign	Het
Sgcd	T	G	11: 47,195,042	K94Q	probably benign	Het
Skor2	A	T	18: 76,859,516	D311V	unknown	Het
Slc17a2	A	T	13: 23,812,640	I43F	probably damaging	Het
Spdye4c	C	A	2: 128,592,622	P40T	probably damaging	Het
Srp72	C	A	5: 76,987,870	Q216K	possibly damaging	Het
Tmem62	C	T	2: 121,007,057	T485I	probably benign	Het
Tmem94	G	T	11: 115,790,230	V432L	probably damaging	Het
Uggt2	A	T	14: 119,054,643	D581E	probably benign	Het
Unc5d	T	A	8: 28,759,081	S319C	probably damaging	Het
Vmn1r211	T	C	13: 22,851,643	I285V	probably damaging	Het
Vmn2r68	A	G	7: 85,233,366	Y393H	possibly damaging	Het
Vmn2r99	A	C	17: 19,377,945	N77T	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTGTCACTCACTTGAGAGTCCC -3'
(R):5'- GAAAGAGTGTGCCATCTCCCTGTC -3'

Sequencing Primer
(F):5'- CGTCGGGGTTCTCCATGATAAC -3'
(R):5'- TGTCTGACTGCCGAGCC -3'

Posted On

2014-05-14