Incidental Mutation 'R1686:Sdk1'
ID189336
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142034537 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 690 (H690L)
Ref Sequence ENSEMBL: ENSMUSP00000074133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: H690L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: H690L

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: H950L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: H950L

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGATGCTCCTGAGACTGTCAC -3'
(R):5'- ACAGGCATGGCTGGCAACCAAG -3'

Sequencing Primer
(F):5'- CTGTAGTCACTATTGCTCCTGACTTC -3'
(R):5'- GAGTCCCTTCCACATTGCAAG -3'
Posted On2014-05-14