Incidental Mutation 'R1686:1700017N19Rik'
ID 189358
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene Name RIKEN cDNA 1700017N19 gene
Synonyms
MMRRC Submission 039719-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1686 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 100426346-100454257 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100448722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 400 (V400I)
Ref Sequence ENSEMBL: ENSMUSP00000139797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041162] [ENSMUST00000186825] [ENSMUST00000187119] [ENSMUST00000188736] [ENSMUST00000190386] [ENSMUST00000190708] [ENSMUST00000191033] [ENSMUST00000191336] [ENSMUST00000218464]
AlphaFold A0A087WPJ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000041162
AA Change: V346I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000186825
Predicted Effect possibly damaging
Transcript: ENSMUST00000187119
AA Change: V305I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000188736
AA Change: V345I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000190386
AA Change: V306I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000190708
AA Change: V400I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000191033
AA Change: V145I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000191336
Predicted Effect possibly damaging
Transcript: ENSMUST00000218464
AA Change: V346I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,848,782 (GRCm39) N14S probably damaging Het
Adamts14 A G 10: 61,034,439 (GRCm39) Y1150H probably benign Het
Adgrg3 A G 8: 95,759,997 (GRCm39) N72S probably benign Het
Akain1 T A 17: 69,746,527 (GRCm39) F3I possibly damaging Het
Akr1c21 T C 13: 4,627,452 (GRCm39) L182P probably damaging Het
Arhgap21 A T 2: 20,886,659 (GRCm39) Y12N probably damaging Het
Aup1 A T 6: 83,032,226 (GRCm39) H131L probably damaging Het
Bag6 A G 17: 35,363,928 (GRCm39) T812A possibly damaging Het
Bmp2k A G 5: 97,211,392 (GRCm39) Y520C unknown Het
Calm4 T G 13: 3,888,302 (GRCm39) V136G probably damaging Het
Catsper2 A G 2: 121,230,523 (GRCm39) probably null Het
Cc2d2a A G 5: 43,896,713 (GRCm39) T1537A possibly damaging Het
Cntn2 A T 1: 132,454,049 (GRCm39) V319D possibly damaging Het
Cux1 G A 5: 136,304,235 (GRCm39) R1314* probably null Het
Cxcl12 A G 6: 117,150,508 (GRCm39) I79V probably damaging Het
Cyp2j6 T C 4: 96,412,014 (GRCm39) D418G probably benign Het
Ddx28 G C 8: 106,737,190 (GRCm39) D289E probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam135a A C 1: 24,068,887 (GRCm39) S448A probably benign Het
Fbxo33 G T 12: 59,251,626 (GRCm39) N30K possibly damaging Het
Fgf12 A C 16: 28,217,093 (GRCm39) Y21D probably damaging Het
Galntl5 C T 5: 25,415,432 (GRCm39) S288L probably benign Het
Gart G T 16: 91,422,237 (GRCm39) A760D probably damaging Het
Gba2 A T 4: 43,573,869 (GRCm39) probably benign Het
Gm10518 C A 1: 179,631,357 (GRCm39) S139* probably null Het
Gm4781 A T 10: 100,232,837 (GRCm39) noncoding transcript Het
Gm9790 A G 3: 85,823,156 (GRCm39) noncoding transcript Het
Gmps G A 3: 63,893,075 (GRCm39) G127R probably damaging Het
Golim4 A T 3: 75,802,443 (GRCm39) V283E probably benign Het
Gprc5a A T 6: 135,055,918 (GRCm39) I122F possibly damaging Het
Gzmc T C 14: 56,471,341 (GRCm39) K67E probably benign Het
Hapln3 C A 7: 78,771,638 (GRCm39) V84L probably benign Het
Hif3a T A 7: 16,778,789 (GRCm39) N377Y possibly damaging Het
Ifi211 G A 1: 173,726,969 (GRCm39) H392Y probably damaging Het
Iqgap3 T A 3: 88,015,663 (GRCm39) probably benign Het
Itga10 T A 3: 96,559,141 (GRCm39) F410Y probably damaging Het
Jup T C 11: 100,263,260 (GRCm39) Y705C probably damaging Het
Khsrp C T 17: 57,332,597 (GRCm39) A228T probably benign Het
Lmntd2 C T 7: 140,790,998 (GRCm39) G445D probably damaging Het
Lyst T C 13: 13,809,290 (GRCm39) V320A possibly damaging Het
Magel2 T A 7: 62,027,988 (GRCm39) H297Q possibly damaging Het
Mbd6 T C 10: 127,123,286 (GRCm39) E33G probably damaging Het
Mob3b A G 4: 34,985,910 (GRCm39) probably benign Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mroh2a C T 1: 88,158,402 (GRCm39) R150* probably null Het
Mymk A T 2: 26,952,346 (GRCm39) W174R probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Nipal3 T C 4: 135,174,599 (GRCm39) Y384C possibly damaging Het
Nt5c3b A G 11: 100,330,920 (GRCm39) probably benign Het
Obox6 T A 7: 15,567,750 (GRCm39) L232F probably damaging Het
Obscn A C 11: 58,997,113 (GRCm39) probably benign Het
Or7g12 T C 9: 18,899,839 (GRCm39) L185P probably damaging Het
Phkb A G 8: 86,748,278 (GRCm39) I706V probably benign Het
Plcb2 A G 2: 118,546,168 (GRCm39) probably benign Het
Plek2 T C 12: 78,941,184 (GRCm39) D216G probably damaging Het
Plxnb2 T C 15: 89,046,665 (GRCm39) Y855C probably damaging Het
Prkcz T C 4: 155,355,713 (GRCm39) T227A probably damaging Het
Psma7 A T 2: 179,679,215 (GRCm39) D184E probably benign Het
Rai14 T A 15: 10,592,282 (GRCm39) L204F probably damaging Het
Ralgapa2 A G 2: 146,199,920 (GRCm39) V1208A probably benign Het
Rapgef6 A G 11: 54,582,458 (GRCm39) R67G possibly damaging Het
Ryr2 C T 13: 11,618,665 (GRCm39) probably benign Het
Satb1 T C 17: 52,047,027 (GRCm39) S763G probably benign Het
Sdk1 A T 5: 142,020,292 (GRCm39) H690L probably benign Het
Sfrp5 A C 19: 42,190,143 (GRCm39) V103G possibly damaging Het
Six6 A G 12: 72,988,451 (GRCm39) E208G probably benign Het
Sspo A T 6: 48,437,334 (GRCm39) H1364L probably benign Het
Stard9 A T 2: 120,529,973 (GRCm39) T2077S probably benign Het
Tacr3 T C 3: 134,535,254 (GRCm39) L74P probably damaging Het
Tep1 T C 14: 51,074,245 (GRCm39) E1880G probably benign Het
Tgfb3 A T 12: 86,116,517 (GRCm39) probably benign Het
Thap7 G A 16: 17,346,576 (GRCm39) P136S probably damaging Het
Thoc2l T A 5: 104,667,789 (GRCm39) Y770* probably null Het
Tmc2 T C 2: 130,098,036 (GRCm39) V717A possibly damaging Het
Usp43 T A 11: 67,778,593 (GRCm39) S446C probably damaging Het
Vwa3a C T 7: 120,379,371 (GRCm39) S492L probably damaging Het
Wdhd1 T A 14: 47,493,672 (GRCm39) N16I probably damaging Het
Wdr95 A T 5: 149,516,566 (GRCm39) D327V probably damaging Het
Zfp128 T G 7: 12,624,563 (GRCm39) Y310* probably null Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100,439,222 (GRCm39) missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100,446,527 (GRCm39) missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100,446,579 (GRCm39) critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100,445,006 (GRCm39) splice site probably benign
IGL02692:1700017N19Rik APN 10 100,439,410 (GRCm39) missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100,446,455 (GRCm39) splice site probably null
R0145:1700017N19Rik UTSW 10 100,437,783 (GRCm39) missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100,445,115 (GRCm39) missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100,448,729 (GRCm39) missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100,439,390 (GRCm39) missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100,439,390 (GRCm39) missense probably damaging 0.98
R3951:1700017N19Rik UTSW 10 100,451,158 (GRCm39) splice site probably benign
R3952:1700017N19Rik UTSW 10 100,451,158 (GRCm39) splice site probably benign
R4423:1700017N19Rik UTSW 10 100,441,495 (GRCm39) missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100,448,680 (GRCm39) splice site probably null
R5507:1700017N19Rik UTSW 10 100,445,095 (GRCm39) missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100,451,070 (GRCm39) missense probably benign 0.20
R5898:1700017N19Rik UTSW 10 100,448,762 (GRCm39) missense possibly damaging 0.56
R5977:1700017N19Rik UTSW 10 100,451,106 (GRCm39) missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100,445,118 (GRCm39) critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100,445,118 (GRCm39) critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100,445,038 (GRCm39) missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100,448,691 (GRCm39) nonsense probably null
R7870:1700017N19Rik UTSW 10 100,441,505 (GRCm39) missense probably benign
R7914:1700017N19Rik UTSW 10 100,428,538 (GRCm39) missense probably benign
R8466:1700017N19Rik UTSW 10 100,437,873 (GRCm39) missense probably benign 0.00
R8558:1700017N19Rik UTSW 10 100,430,497 (GRCm39) missense probably benign 0.23
R9004:1700017N19Rik UTSW 10 100,454,197 (GRCm39) unclassified probably benign
R9105:1700017N19Rik UTSW 10 100,439,407 (GRCm39) nonsense probably null
R9641:1700017N19Rik UTSW 10 100,430,498 (GRCm39) missense possibly damaging 0.91
Z1088:1700017N19Rik UTSW 10 100,441,501 (GRCm39) missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100,448,291 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTGAATGATGTCCAGCCAGTGAG -3'
(R):5'- AGGAGTGAAGATCAGCTTCCCGTG -3'

Sequencing Primer
(F):5'- AAAGAACTTTCCTGGCTCTGG -3'
(R):5'- CGTGGGGGAAATCCTGAGTC -3'
Posted On 2014-05-14