Incidental Mutation 'R1686:Six6'
ID189367
Institutional Source Beutler Lab
Gene Symbol Six6
Ensembl Gene ENSMUSG00000021099
Gene Namesine oculis-related homeobox 6
SynonymsOptx2, Six9
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1686 (G1)
Quality Score207
Status Validated
Chromosome12
Chromosomal Location72939892-72944899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72941677 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 208 (E208G)
Ref Sequence ENSEMBL: ENSMUSP00000021519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021519] [ENSMUST00000130635] [ENSMUST00000132067] [ENSMUST00000136075]
Predicted Effect probably benign
Transcript: ENSMUST00000021519
AA Change: E208G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021519
Gene: ENSMUSG00000021099
AA Change: E208G

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 123 4.3e-50 PFAM
HOX 129 190 5.5e-15 SMART
low complexity region 219 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130635
Predicted Effect probably benign
Transcript: ENSMUST00000132067
Predicted Effect probably benign
Transcript: ENSMUST00000136075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223260
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 12 and is thought to be involved in eye development. The encoded transcription factor regulates early progenitor cell proliferation during mammalian retinogenesis and pituitary development. Mice lacking this gene exhibit abnormal development of the suprachiasmatic nucleus and circadian rhythms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal and pituitary hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Six6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Six6 APN 12 72940057 start codon destroyed probably null 0.86
R1920:Six6 UTSW 12 72941764 missense probably damaging 0.99
R5391:Six6 UTSW 12 72941701 nonsense probably null
R5395:Six6 UTSW 12 72941701 nonsense probably null
R6879:Six6 UTSW 12 72940524 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATTCCGCGAAAGAGCTGTGGTG -3'
(R):5'- TGCAGCCAGATCCTTCAGGAAAAG -3'

Sequencing Primer
(F):5'- GTGCATCGGTCCAAACCC -3'
(R):5'- TCCTTCAGGAAAAGCAATGCG -3'
Posted On2014-05-14