Incidental Mutation 'R1686:Tep1'
ID189375
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50836788 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1880 (E1880G)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000227526]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
AA Change: E1880G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: E1880G

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227228
Predicted Effect probably benign
Transcript: ENSMUST00000227526
Meta Mutation Damage Score 0.1406 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 splice site probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 splice site probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
R7901:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R7961:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R7993:Tep1 UTSW 14 50830253 missense probably benign 0.41
R8009:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R8085:Tep1 UTSW 14 50829296 missense probably benign 0.11
R8299:Tep1 UTSW 14 50868045 missense probably benign 0.06
R8330:Tep1 UTSW 14 50847705 missense possibly damaging 0.86
R8396:Tep1 UTSW 14 50837072 missense probably benign 0.23
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Z1177:Tep1 UTSW 14 50847765 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAGCAGGAACCTTCTTTCCAAG -3'
(R):5'- TCCATGTCGTTTTGAGCCCATACTG -3'

Sequencing Primer
(F):5'- ccgcccactcccATGAC -3'
(R):5'- CATACTGAGAACAGGCTCTGTTG -3'
Posted On2014-05-14