Incidental Mutation 'R1687:Camsap1'
ID189394
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission 039720-MU
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25939615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 699 (F699S)
Ref Sequence ENSEMBL: ENSMUSP00000139028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000183461]
Predicted Effect probably damaging
Transcript: ENSMUST00000091268
AA Change: F699S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: F699S

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114167
AA Change: F699S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: F699S

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134882
AA Change: F719S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: F719S

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134970
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect probably damaging
Transcript: ENSMUST00000183461
AA Change: F699S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: F699S

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCTGAGAAGTGGTGCTCAGAC -3'
(R):5'- CGTGACCTGAACAGAACTTTCACCC -3'

Sequencing Primer
(F):5'- TCACCAGCATATCTGGGGATAAC -3'
(R):5'- ACCCCAATTCCTTGTTCAGAATTTG -3'
Posted On2014-05-14