Incidental Mutation 'R1687:Fubp1'
ID189406
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 152228201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196429] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000198227] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect unknown
Transcript: ENSMUST00000106121
AA Change: Q577R
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034
AA Change: Q577R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000166984
AA Change: Q577R
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034
AA Change: Q577R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196429
SMART Domains Protein: ENSMUSP00000143478
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
KH 1 69 1.1e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196695
AA Change: Q578R
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034
AA Change: Q578R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000196739
AA Change: Q575R
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034
AA Change: Q575R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198046
Predicted Effect probably benign
Transcript: ENSMUST00000198227
SMART Domains Protein: ENSMUSP00000143370
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 94 164 6.9e-20 SMART
KH 179 251 1.5e-19 SMART
KH 269 339 8.1e-19 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 7.2e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000198405
AA Change: R72G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect unknown
Transcript: ENSMUST00000199876
AA Change: Q578R
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034
AA Change: Q578R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199918
AA Change: Q76R
Predicted Effect unknown
Transcript: ENSMUST00000200056
AA Change: Q68R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200207
Predicted Effect unknown
Transcript: ENSMUST00000200452
AA Change: Q577R
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034
AA Change: Q577R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000200524
AA Change: Q578R
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034
AA Change: Q578R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0166:Fubp1 UTSW 3 152220204 nonsense probably null
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R3880:Fubp1 UTSW 3 152220496 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4564:Fubp1 UTSW 3 152222936 nonsense probably null
R4776:Fubp1 UTSW 3 152222068 intron probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6254:Fubp1 UTSW 3 152232408 missense possibly damaging 0.66
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R7132:Fubp1 UTSW 3 152232024 critical splice donor site probably null
R7612:Fubp1 UTSW 3 152218015 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGGATGAACCATGCTTGAACTGTC -3'
(R):5'- ACTTCCAGTCAATTTCAGGATGTCACC -3'

Sequencing Primer
(F):5'- CCATGCTTGAACTGTCCTTAAAAATG -3'
(R):5'- gtctaagagtcccaagtgtcc -3'
Posted On2014-05-14