Incidental Mutation 'R1687:Tnni3k'
ID189408
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene NameTNNI3 interacting kinase
SynonymsCark, D830019J24Rik
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154786291-155055407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154939626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 541 (I541F)
Ref Sequence ENSEMBL: ENSMUSP00000122478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064076
AA Change: I541F

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: I541F

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143410
AA Change: I541F

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086
AA Change: I541F

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 155054555 missense probably benign 0.00
IGL00852:Tnni3k APN 3 155054569 missense probably benign 0.00
IGL01090:Tnni3k APN 3 154939683 missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154941029 splice site probably null
IGL01724:Tnni3k APN 3 154939626 missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154875187 splice site probably null
IGL01992:Tnni3k APN 3 154962026 missense probably damaging 0.99
IGL02945:Tnni3k APN 3 155037438 missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154957758 missense probably benign 0.01
IGL03069:Tnni3k APN 3 154941605 splice site probably null
IGL03325:Tnni3k APN 3 154961814 missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154792767 splice site probably benign
R0211:Tnni3k UTSW 3 155055344 start gained probably benign
R0682:Tnni3k UTSW 3 154940028 missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154961972 missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154941679 missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154792777 missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1476:Tnni3k UTSW 3 155030305 missense probably benign 0.05
R1496:Tnni3k UTSW 3 154939658 missense probably damaging 1.00
R1704:Tnni3k UTSW 3 154827508 missense probably benign 0.27
R1913:Tnni3k UTSW 3 154979199 missense probably benign 0.00
R2343:Tnni3k UTSW 3 154938829 missense probably benign 0.00
R2374:Tnni3k UTSW 3 154786785 missense probably benign 0.12
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2873:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R4858:Tnni3k UTSW 3 154786808 splice site probably null
R5597:Tnni3k UTSW 3 154872128 missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154827611 missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 155030370 missense probably benign 0.23
R6467:Tnni3k UTSW 3 154969285 missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154941058 nonsense probably null
R6882:Tnni3k UTSW 3 154957720 missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154792776 missense probably benign 0.14
R6986:Tnni3k UTSW 3 154961864 missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154875145 missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154962031 missense probably benign 0.01
Z1088:Tnni3k UTSW 3 154939670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACCACCCCATAGTTGCTGTCC -3'
(R):5'- GACATGAATGTGTCCCCACTCCTG -3'

Sequencing Primer
(F):5'- TGCTGTCCGCAGAGATCTAAG -3'
(R):5'- ACTCCTGTCCTAGATACCGAG -3'
Posted On2014-05-14