Incidental Mutation 'R1687:Depdc5'
ID 189411
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 039720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1687 (G1)
Quality Score 179
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT at 33067751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably benign
Transcript: ENSMUST00000049780
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087897
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119705
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158455
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Predicted Effect probably benign
Transcript: ENSMUST00000201836
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,714 (GRCm39) F931I probably benign Het
Alox15 T A 11: 70,240,744 (GRCm39) H212L probably benign Het
Arhgap42 A T 9: 9,035,538 (GRCm39) V268D probably benign Het
Armc9 A G 1: 86,084,677 (GRCm39) M1V probably null Het
Brca1 C T 11: 101,380,666 (GRCm39) C1789Y probably benign Het
Cacng4 A G 11: 107,627,585 (GRCm39) V138A probably benign Het
Camsap1 A G 2: 25,829,627 (GRCm39) F699S probably damaging Het
Ccm2 A G 11: 6,535,118 (GRCm39) R67G probably damaging Het
Cdk16 G A X: 20,562,898 (GRCm39) probably null Het
Cep85 T C 4: 133,875,324 (GRCm39) H546R probably benign Het
Cfap54 T C 10: 92,768,502 (GRCm39) D207G probably damaging Het
Cldn9 G T 17: 23,902,050 (GRCm39) R192S probably benign Het
Crybb3 A G 5: 113,227,633 (GRCm39) S63P probably damaging Het
Cux1 A G 5: 136,341,523 (GRCm39) L615P probably damaging Het
Dctn3 A G 4: 41,715,407 (GRCm39) Y154H probably damaging Het
Dnah3 A T 7: 119,645,009 (GRCm39) probably null Het
Eif1ad2 A G 12: 87,786,488 (GRCm39) D133G unknown Het
Eml6 G A 11: 29,783,187 (GRCm39) H565Y probably damaging Het
Ephb6 T C 6: 41,594,300 (GRCm39) V610A probably benign Het
Fam234a T C 17: 26,434,282 (GRCm39) Y333C probably damaging Het
Fbln1 G A 15: 85,111,307 (GRCm39) V154I probably benign Het
Frem2 A T 3: 53,561,373 (GRCm39) W1045R probably benign Het
Fubp1 A G 3: 151,933,838 (GRCm39) probably benign Het
Gja3 T A 14: 57,274,333 (GRCm39) N13I probably damaging Het
Gpr20 C A 15: 73,567,751 (GRCm39) V213L probably benign Het
Grk5 T C 19: 61,065,221 (GRCm39) I295T probably damaging Het
Gucy1b1 A G 3: 81,945,349 (GRCm39) F430L probably damaging Het
Gzmk T A 13: 113,310,462 (GRCm39) I119L probably benign Het
Hadh T C 3: 131,038,898 (GRCm39) I153V probably benign Het
Hsfy2 T C 1: 56,676,012 (GRCm39) Y175C probably damaging Het
Hspa5 T C 2: 34,665,836 (GRCm39) I560T probably benign Het
Igdcc4 T C 9: 65,038,945 (GRCm39) V863A probably damaging Het
Il22ra2 A G 10: 19,508,620 (GRCm39) D216G probably benign Het
Klc2 G A 19: 5,161,682 (GRCm39) P303S probably damaging Het
Lama5 C T 2: 179,835,859 (GRCm39) V1192I probably benign Het
Mon2 A G 10: 122,862,029 (GRCm39) S772P probably damaging Het
Mphosph8 T A 14: 56,909,935 (GRCm39) L96Q probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Nckap1 A G 2: 80,350,929 (GRCm39) I726T probably damaging Het
Ndnf A T 6: 65,680,407 (GRCm39) T229S probably benign Het
Npas3 A T 12: 54,095,658 (GRCm39) probably null Het
Nrap C T 19: 56,343,961 (GRCm39) E729K probably damaging Het
Nsun2 T A 13: 69,775,716 (GRCm39) F387I probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Pabpc1l C T 2: 163,886,226 (GRCm39) T452M probably benign Het
Pcdh10 T C 3: 45,334,450 (GRCm39) Y255H probably damaging Het
Pdcd6ip A T 9: 113,529,087 (GRCm39) Y72N probably damaging Het
Pglyrp1 A T 7: 18,618,629 (GRCm39) probably benign Het
Pkp2 T C 16: 16,086,573 (GRCm39) probably null Het
Ppard A G 17: 28,516,154 (GRCm39) Y126C probably damaging Het
Prkcq T C 2: 11,295,344 (GRCm39) Y598H probably damaging Het
Rhobtb1 A G 10: 69,106,109 (GRCm39) T287A probably damaging Het
Sema4b T C 7: 79,869,010 (GRCm39) Y361H probably damaging Het
Slfn9 A T 11: 82,872,983 (GRCm39) I640N probably damaging Het
Smurf2 C A 11: 106,726,896 (GRCm39) probably null Het
Spag5 T C 11: 78,195,755 (GRCm39) V354A probably benign Het
Sptb T C 12: 76,650,473 (GRCm39) D1748G possibly damaging Het
St6galnac5 C A 3: 152,686,887 (GRCm39) L22F probably benign Het
Sugp2 T C 8: 70,695,284 (GRCm39) S86P probably damaging Het
Tnk1 T C 11: 69,747,299 (GRCm39) I111V possibly damaging Het
Tnni3k T A 3: 154,645,263 (GRCm39) I541F possibly damaging Het
Trim36 G T 18: 46,321,724 (GRCm39) H108N possibly damaging Het
Ttn T C 2: 76,701,251 (GRCm39) probably benign Het
Usp28 T A 9: 48,935,317 (GRCm39) S89R probably benign Het
Vmn2r121 T C X: 123,042,488 (GRCm39) D223G probably benign Het
Vmn2r65 T A 7: 84,590,026 (GRCm39) Y630F probably benign Het
Washc2 T A 6: 116,233,673 (GRCm39) S900T probably benign Het
Wdr72 A G 9: 74,117,481 (GRCm39) N731S probably benign Het
Xrra1 T A 7: 99,525,451 (GRCm39) F123L probably damaging Het
Zfp648 A G 1: 154,079,988 (GRCm39) D49G probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAAAGCCAAGCACAGGTGCG -3'
(R):5'- AGAGCCAGACAGCCTGCTTTCC -3'

Sequencing Primer
(F):5'- gccaactttatccagcactc -3'
(R):5'- tgctggggactgaatcaag -3'
Posted On 2014-05-14