Incidental Mutation 'R1687:Ephb6'
ID 189415
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene Name Eph receptor B6
Synonyms Cekl, Mep
MMRRC Submission 039720-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.680) question?
Stock # R1687 (G1)
Quality Score 191
Status Not validated
Chromosome 6
Chromosomal Location 41582416-41597443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41594300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 610 (V610A)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
AlphaFold O08644
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
AA Change: V610A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: V610A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,714 (GRCm39) F931I probably benign Het
Alox15 T A 11: 70,240,744 (GRCm39) H212L probably benign Het
Arhgap42 A T 9: 9,035,538 (GRCm39) V268D probably benign Het
Armc9 A G 1: 86,084,677 (GRCm39) M1V probably null Het
Brca1 C T 11: 101,380,666 (GRCm39) C1789Y probably benign Het
Cacng4 A G 11: 107,627,585 (GRCm39) V138A probably benign Het
Camsap1 A G 2: 25,829,627 (GRCm39) F699S probably damaging Het
Ccm2 A G 11: 6,535,118 (GRCm39) R67G probably damaging Het
Cdk16 G A X: 20,562,898 (GRCm39) probably null Het
Cep85 T C 4: 133,875,324 (GRCm39) H546R probably benign Het
Cfap54 T C 10: 92,768,502 (GRCm39) D207G probably damaging Het
Cldn9 G T 17: 23,902,050 (GRCm39) R192S probably benign Het
Crybb3 A G 5: 113,227,633 (GRCm39) S63P probably damaging Het
Cux1 A G 5: 136,341,523 (GRCm39) L615P probably damaging Het
Dctn3 A G 4: 41,715,407 (GRCm39) Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 33,067,751 (GRCm39) probably benign Het
Dnah3 A T 7: 119,645,009 (GRCm39) probably null Het
Eif1ad2 A G 12: 87,786,488 (GRCm39) D133G unknown Het
Eml6 G A 11: 29,783,187 (GRCm39) H565Y probably damaging Het
Fam234a T C 17: 26,434,282 (GRCm39) Y333C probably damaging Het
Fbln1 G A 15: 85,111,307 (GRCm39) V154I probably benign Het
Frem2 A T 3: 53,561,373 (GRCm39) W1045R probably benign Het
Fubp1 A G 3: 151,933,838 (GRCm39) probably benign Het
Gja3 T A 14: 57,274,333 (GRCm39) N13I probably damaging Het
Gpr20 C A 15: 73,567,751 (GRCm39) V213L probably benign Het
Grk5 T C 19: 61,065,221 (GRCm39) I295T probably damaging Het
Gucy1b1 A G 3: 81,945,349 (GRCm39) F430L probably damaging Het
Gzmk T A 13: 113,310,462 (GRCm39) I119L probably benign Het
Hadh T C 3: 131,038,898 (GRCm39) I153V probably benign Het
Hsfy2 T C 1: 56,676,012 (GRCm39) Y175C probably damaging Het
Hspa5 T C 2: 34,665,836 (GRCm39) I560T probably benign Het
Igdcc4 T C 9: 65,038,945 (GRCm39) V863A probably damaging Het
Il22ra2 A G 10: 19,508,620 (GRCm39) D216G probably benign Het
Klc2 G A 19: 5,161,682 (GRCm39) P303S probably damaging Het
Lama5 C T 2: 179,835,859 (GRCm39) V1192I probably benign Het
Mon2 A G 10: 122,862,029 (GRCm39) S772P probably damaging Het
Mphosph8 T A 14: 56,909,935 (GRCm39) L96Q probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Nckap1 A G 2: 80,350,929 (GRCm39) I726T probably damaging Het
Ndnf A T 6: 65,680,407 (GRCm39) T229S probably benign Het
Npas3 A T 12: 54,095,658 (GRCm39) probably null Het
Nrap C T 19: 56,343,961 (GRCm39) E729K probably damaging Het
Nsun2 T A 13: 69,775,716 (GRCm39) F387I probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Pabpc1l C T 2: 163,886,226 (GRCm39) T452M probably benign Het
Pcdh10 T C 3: 45,334,450 (GRCm39) Y255H probably damaging Het
Pdcd6ip A T 9: 113,529,087 (GRCm39) Y72N probably damaging Het
Pglyrp1 A T 7: 18,618,629 (GRCm39) probably benign Het
Pkp2 T C 16: 16,086,573 (GRCm39) probably null Het
Ppard A G 17: 28,516,154 (GRCm39) Y126C probably damaging Het
Prkcq T C 2: 11,295,344 (GRCm39) Y598H probably damaging Het
Rhobtb1 A G 10: 69,106,109 (GRCm39) T287A probably damaging Het
Sema4b T C 7: 79,869,010 (GRCm39) Y361H probably damaging Het
Slfn9 A T 11: 82,872,983 (GRCm39) I640N probably damaging Het
Smurf2 C A 11: 106,726,896 (GRCm39) probably null Het
Spag5 T C 11: 78,195,755 (GRCm39) V354A probably benign Het
Sptb T C 12: 76,650,473 (GRCm39) D1748G possibly damaging Het
St6galnac5 C A 3: 152,686,887 (GRCm39) L22F probably benign Het
Sugp2 T C 8: 70,695,284 (GRCm39) S86P probably damaging Het
Tnk1 T C 11: 69,747,299 (GRCm39) I111V possibly damaging Het
Tnni3k T A 3: 154,645,263 (GRCm39) I541F possibly damaging Het
Trim36 G T 18: 46,321,724 (GRCm39) H108N possibly damaging Het
Ttn T C 2: 76,701,251 (GRCm39) probably benign Het
Usp28 T A 9: 48,935,317 (GRCm39) S89R probably benign Het
Vmn2r121 T C X: 123,042,488 (GRCm39) D223G probably benign Het
Vmn2r65 T A 7: 84,590,026 (GRCm39) Y630F probably benign Het
Washc2 T A 6: 116,233,673 (GRCm39) S900T probably benign Het
Wdr72 A G 9: 74,117,481 (GRCm39) N731S probably benign Het
Xrra1 T A 7: 99,525,451 (GRCm39) F123L probably damaging Het
Zfp648 A G 1: 154,079,988 (GRCm39) D49G probably benign Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41,592,845 (GRCm39) unclassified probably benign
IGL01691:Ephb6 APN 6 41,591,449 (GRCm39) missense probably benign 0.26
IGL02052:Ephb6 APN 6 41,590,256 (GRCm39) missense probably benign
IGL02079:Ephb6 APN 6 41,592,948 (GRCm39) missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41,591,108 (GRCm39) missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41,594,219 (GRCm39) missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41,591,503 (GRCm39) missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41,591,503 (GRCm39) missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41,596,528 (GRCm39) unclassified probably benign
R0106:Ephb6 UTSW 6 41,596,528 (GRCm39) unclassified probably benign
R0973:Ephb6 UTSW 6 41,591,038 (GRCm39) missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41,591,038 (GRCm39) missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41,591,038 (GRCm39) missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41,593,040 (GRCm39) missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41,593,040 (GRCm39) missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41,591,307 (GRCm39) nonsense probably null
R1658:Ephb6 UTSW 6 41,591,179 (GRCm39) missense probably damaging 1.00
R1733:Ephb6 UTSW 6 41,596,654 (GRCm39) missense probably benign 0.10
R2191:Ephb6 UTSW 6 41,593,019 (GRCm39) missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41,595,669 (GRCm39) missense probably benign 0.31
R2915:Ephb6 UTSW 6 41,591,172 (GRCm39) missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41,591,455 (GRCm39) missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41,593,093 (GRCm39) nonsense probably null
R4606:Ephb6 UTSW 6 41,593,508 (GRCm39) missense probably benign 0.15
R4663:Ephb6 UTSW 6 41,594,799 (GRCm39) missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41,591,536 (GRCm39) missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41,595,094 (GRCm39) missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41,591,119 (GRCm39) missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41,593,073 (GRCm39) missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41,593,743 (GRCm39) missense probably benign
R4851:Ephb6 UTSW 6 41,595,079 (GRCm39) missense probably benign 0.00
R5016:Ephb6 UTSW 6 41,595,041 (GRCm39) missense probably benign 0.01
R5122:Ephb6 UTSW 6 41,590,338 (GRCm39) missense probably benign 0.00
R5313:Ephb6 UTSW 6 41,593,727 (GRCm39) missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41,596,225 (GRCm39) missense probably benign
R5623:Ephb6 UTSW 6 41,593,415 (GRCm39) missense probably benign 0.20
R5686:Ephb6 UTSW 6 41,596,638 (GRCm39) missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41,592,507 (GRCm39) missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41,593,715 (GRCm39) missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41,594,206 (GRCm39) missense probably benign 0.01
R6730:Ephb6 UTSW 6 41,594,308 (GRCm39) nonsense probably null
R7412:Ephb6 UTSW 6 41,597,173 (GRCm39) missense probably damaging 1.00
R7442:Ephb6 UTSW 6 41,594,981 (GRCm39) splice site probably null
R7759:Ephb6 UTSW 6 41,591,539 (GRCm39) missense probably benign 0.00
R7857:Ephb6 UTSW 6 41,590,331 (GRCm39) missense probably benign
R8425:Ephb6 UTSW 6 41,595,580 (GRCm39) missense probably damaging 0.98
R8697:Ephb6 UTSW 6 41,591,157 (GRCm39) missense probably damaging 0.99
R8898:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R8959:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R8961:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R8980:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R8989:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R8992:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R9065:Ephb6 UTSW 6 41,590,293 (GRCm39) missense probably benign
R9413:Ephb6 UTSW 6 41,591,509 (GRCm39) missense
R9512:Ephb6 UTSW 6 41,593,030 (GRCm39) missense possibly damaging 0.70
R9617:Ephb6 UTSW 6 41,596,258 (GRCm39) missense probably damaging 1.00
R9619:Ephb6 UTSW 6 41,594,249 (GRCm39) missense possibly damaging 0.72
R9705:Ephb6 UTSW 6 41,596,715 (GRCm39) missense probably benign 0.05
R9764:Ephb6 UTSW 6 41,592,911 (GRCm39) missense probably benign 0.01
X0027:Ephb6 UTSW 6 41,597,014 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- GCATGTGAACACAAAGCAAGCCTG -3'
(R):5'- CGCTTCCTGAGAGGCAAACCAATAG -3'

Sequencing Primer
(F):5'- AAGCAAGCCTGGCTCCTC -3'
(R):5'- AGCCTAGAATGACACTTGCTTC -3'
Posted On 2014-05-14