Incidental Mutation 'R1687:Sema4b'
ID189421
Institutional Source Beutler Lab
Gene Symbol Sema4b
Ensembl Gene ENSMUSG00000030539
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
SynonymsSemac, SemC
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80186841-80226527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80219262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 361 (Y361H)
Ref Sequence ENSEMBL: ENSMUSP00000145622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000205822]
Predicted Effect probably damaging
Transcript: ENSMUST00000032754
AA Change: Y361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539
AA Change: Y361H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107383
SMART Domains Protein: ENSMUSP00000103006
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 550 2.68e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205822
AA Change: Y361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal cerebellar morphology. Mice homozygous for a knock-out allele exhibit enhanced memory response by way of increased IgE and IgG1 serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Sema4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Sema4b APN 7 80215696 missense probably damaging 1.00
IGL02584:Sema4b APN 7 80224988 missense probably benign
IGL02657:Sema4b APN 7 80217041 missense probably damaging 1.00
false_flag UTSW 7 80198654 start codon destroyed probably null
R0114:Sema4b UTSW 7 80219078 splice site probably benign
R0480:Sema4b UTSW 7 80220206 missense probably damaging 1.00
R1184:Sema4b UTSW 7 80224640 missense probably benign 0.27
R1545:Sema4b UTSW 7 80219023 missense probably benign 0.02
R1880:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R1881:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R2180:Sema4b UTSW 7 80212835 missense probably benign 0.28
R2352:Sema4b UTSW 7 80220879 missense probably damaging 0.99
R2424:Sema4b UTSW 7 80219275 missense probably damaging 1.00
R3913:Sema4b UTSW 7 80220474 missense probably benign
R4353:Sema4b UTSW 7 80215651 missense probably damaging 1.00
R4757:Sema4b UTSW 7 80216829 missense probably damaging 1.00
R4921:Sema4b UTSW 7 80198756 missense possibly damaging 0.77
R5004:Sema4b UTSW 7 80216345 missense probably benign 0.13
R5399:Sema4b UTSW 7 80224886 missense probably benign
R5599:Sema4b UTSW 7 80213291 missense probably benign 0.40
R5820:Sema4b UTSW 7 80224958 missense probably damaging 0.99
R5840:Sema4b UTSW 7 80218949 missense probably damaging 1.00
R5901:Sema4b UTSW 7 80224967 missense possibly damaging 0.49
R6600:Sema4b UTSW 7 80212928 missense probably benign 0.42
R6749:Sema4b UTSW 7 80220201 missense possibly damaging 0.56
R6992:Sema4b UTSW 7 80220152 missense probably damaging 0.97
R7175:Sema4b UTSW 7 80198654 start codon destroyed probably null
R7660:Sema4b UTSW 7 80220247 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTTACCTCCCAGTGGTGAGATGC -3'
(R):5'- CCTGCTGCCTTTGAGACAGACAAC -3'

Sequencing Primer
(F):5'- TTAGCTGGGGACAGGAGG -3'
(R):5'- AAGCCAGGGCTTATTACGC -3'
Posted On2014-05-14