Incidental Mutation 'R1687:Dnah3'
ID189425
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1687 (G1)
Quality Score153
Status Not validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 120045786 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably null
Transcript: ENSMUST00000046993
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209154
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 splice site probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 splice site probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
R7431:Dnah3 UTSW 7 120051744 missense probably damaging 1.00
R7499:Dnah3 UTSW 7 120060912 missense probably damaging 0.99
R7515:Dnah3 UTSW 7 120073592 missense probably benign 0.21
R7564:Dnah3 UTSW 7 119971594 missense probably benign
R7618:Dnah3 UTSW 7 119978378 missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119967434 missense
R7728:Dnah3 UTSW 7 119938828 missense probably damaging 1.00
R7757:Dnah3 UTSW 7 120071570 missense probably benign
R7757:Dnah3 UTSW 7 119971215 splice site probably null
R7774:Dnah3 UTSW 7 119951752 nonsense probably null
R7804:Dnah3 UTSW 7 119952618 missense probably damaging 1.00
R7804:Dnah3 UTSW 7 120011012 missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119951704 missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119967552 missense
R7903:Dnah3 UTSW 7 120042128 missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R7989:Dnah3 UTSW 7 120077789 missense probably benign
R8142:Dnah3 UTSW 7 120060966 missense probably benign 0.00
R8164:Dnah3 UTSW 7 119967614 missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119926413 missense probably benign 0.01
R8313:Dnah3 UTSW 7 119951152 missense probably benign 0.38
R8338:Dnah3 UTSW 7 120071881 missense probably benign 0.01
R8355:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119952505 missense probably damaging 1.00
R8411:Dnah3 UTSW 7 120011030 missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119967803 missense
Z1177:Dnah3 UTSW 7 119967901 missense probably damaging 0.99
Z1177:Dnah3 UTSW 7 120007862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAAGAGCAATCTTAGATACCTGGGGA -3'
(R):5'- TGATAGTGTCAGCAGTGTCACCAGT -3'

Sequencing Primer
(F):5'- GGAAAAAGAGCCTCTTCTTCTCC -3'
(R):5'- tgtgtgtctgtctgtgtgtc -3'
Posted On2014-05-14