Incidental Mutation 'R1687:Sugp2'
ID189426
Institutional Source Beutler Lab
Gene Symbol Sugp2
Ensembl Gene ENSMUSG00000036054
Gene NameSURP and G patch domain containing 2
SynonymsSrsf14, Sfrs14
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70234226-70279915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70242634 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 86 (S86P)
Ref Sequence ENSEMBL: ENSMUSP00000128029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093458] [ENSMUST00000131489] [ENSMUST00000145078] [ENSMUST00000155771] [ENSMUST00000164403]
Predicted Effect probably damaging
Transcript: ENSMUST00000093458
AA Change: S86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091167
Gene: ENSMUSG00000036054
AA Change: S86P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131489
AA Change: S86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114833
Gene: ENSMUSG00000036054
AA Change: S86P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136758
Predicted Effect possibly damaging
Transcript: ENSMUST00000145078
AA Change: S153P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114403
Gene: ENSMUSG00000036054
AA Change: S153P

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155771
AA Change: S86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156330
Predicted Effect probably damaging
Transcript: ENSMUST00000164403
AA Change: S86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128029
Gene: ENSMUSG00000036054
AA Change: S86P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arginine/serine-rich family of splicing factors. The encoded protein functions in mRNA processing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Sugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sugp2 APN 8 70242535 missense probably damaging 1.00
IGL01126:Sugp2 APN 8 70251874 missense probably damaging 1.00
IGL01154:Sugp2 APN 8 70242699 missense probably damaging 1.00
IGL02037:Sugp2 APN 8 70259674 splice site probably benign
IGL02401:Sugp2 APN 8 70243171 missense possibly damaging 0.75
IGL02738:Sugp2 APN 8 70243799 missense probably damaging 1.00
IGL03060:Sugp2 APN 8 70243187 missense possibly damaging 0.89
PIT4687001:Sugp2 UTSW 8 70257512 missense probably damaging 0.96
PIT4791001:Sugp2 UTSW 8 70260545 nonsense probably null
R0538:Sugp2 UTSW 8 70258948 missense probably damaging 1.00
R1459:Sugp2 UTSW 8 70244064 splice site probably benign
R1801:Sugp2 UTSW 8 70236710 missense possibly damaging 0.86
R1914:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R1915:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R2004:Sugp2 UTSW 8 70242656 unclassified probably null
R2012:Sugp2 UTSW 8 70243211 missense possibly damaging 0.78
R4584:Sugp2 UTSW 8 70251898 missense probably benign 0.13
R4791:Sugp2 UTSW 8 70242790 missense probably damaging 1.00
R4970:Sugp2 UTSW 8 70259812 missense possibly damaging 0.94
R5101:Sugp2 UTSW 8 70260489 missense probably damaging 1.00
R5240:Sugp2 UTSW 8 70243275 missense probably benign 0.00
R5279:Sugp2 UTSW 8 70257107 intron probably benign
R5303:Sugp2 UTSW 8 70242177 intron probably benign
R5966:Sugp2 UTSW 8 70252103 critical splice donor site probably null
R5988:Sugp2 UTSW 8 70243225 missense probably benign
R6615:Sugp2 UTSW 8 70242770 missense possibly damaging 0.92
R7382:Sugp2 UTSW 8 70242844 missense probably benign 0.02
R7803:Sugp2 UTSW 8 70252072 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATTGTTTGCACCTCACACCTGTC -3'
(R):5'- TGGCCCAAGTCTTGTTCCCAAGAG -3'

Sequencing Primer
(F):5'- TAGAGTCCATGCTCTAAAGTGCC -3'
(R):5'- TTGTTCCCAAGAGCCACG -3'
Posted On2014-05-14