Incidental Mutation 'R1687:Il22ra2'
ID189433
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Nameinterleukin 22 receptor, alpha 2
SynonymsIl-22bp
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19621998-19634681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19632872 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
Predicted Effect probably benign
Transcript: ENSMUST00000036564
AA Change: D216G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: D216G

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19626744 missense probably benign 0.04
IGL02835:Il22ra2 UTSW 10 19626676 missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R1802:Il22ra2 UTSW 10 19626699 missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R3936:Il22ra2 UTSW 10 19631708 missense probably benign 0.00
R4063:Il22ra2 UTSW 10 19626652 missense possibly damaging 0.88
R4559:Il22ra2 UTSW 10 19626712 missense possibly damaging 0.90
R7578:Il22ra2 UTSW 10 19631624 missense probably benign 0.10
R7661:Il22ra2 UTSW 10 19622078 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCATCCTTAGCCTTCCAGGAGAC -3'
(R):5'- TCCTTGAAAAGTGTGGGTAGACATTGC -3'

Sequencing Primer
(F):5'- AGACATCCTGTGGCATGAC -3'
(R):5'- GGGTAGACATTGCTCTAAGAAAATC -3'
Posted On2014-05-14