Incidental Mutation 'R1687:Brca1'
ID189443
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101489840 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1789 (C1789Y)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: C1789Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: C1789Y

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense not run
R8046:Brca1 UTSW 11 101525470 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGTCTCTCCAAGAACGATATGCAAC -3'
(R):5'- TCTGAGTACCTGCTTAGCCCTAAGAAC -3'

Sequencing Primer
(F):5'- GCAACAGATTAGCATCTTGCTC -3'
(R):5'- CTGCTTAGCCCTAAGAACTTATATAC -3'
Posted On2014-05-14