Mutagenetix > Incidental Mutations

Incidental Mutation 'R1687:Brca1'

189443

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

039720-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101489840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 1789 (C1789Y)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: C1789Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: C1789Y

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,888	F931I	probably benign	Het
Alox15	T	A	11: 70,349,918	H212L	probably benign	Het
Arhgap42	A	T	9: 9,035,537	V268D	probably benign	Het
Armc9	A	G	1: 86,156,955	M1V	probably null	Het
BB287469	A	G	12: 87,819,718	D133G	unknown	Het
Cacng4	A	G	11: 107,736,759	V138A	probably benign	Het
Camsap1	A	G	2: 25,939,615	F699S	probably damaging	Het
Ccm2	A	G	11: 6,585,118	R67G	probably damaging	Het
Cdk16	G	A	X: 20,696,659		probably null	Het
Cep85	T	C	4: 134,148,013	H546R	probably benign	Het
Cfap54	T	C	10: 92,932,640	D207G	probably damaging	Het
Cldn9	G	T	17: 23,683,076	R192S	probably benign	Het
Crybb3	A	G	5: 113,079,767	S63P	probably damaging	Het
Cux1	A	G	5: 136,312,669	L615P	probably damaging	Het
Dctn3	A	G	4: 41,715,407	Y154H	probably damaging	Het
Depdc5	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	5: 32,910,407		probably benign	Het
Dnah3	A	T	7: 120,045,786		probably null	Het
Eml6	G	A	11: 29,833,187	H565Y	probably damaging	Het
Ephb6	T	C	6: 41,617,366	V610A	probably benign	Het
Fam234a	T	C	17: 26,215,308	Y333C	probably damaging	Het
Fbln1	G	A	15: 85,227,106	V154I	probably benign	Het
Frem2	A	T	3: 53,653,952	W1045R	probably benign	Het
Fubp1	A	G	3: 152,228,201		probably benign	Het
Gja3	T	A	14: 57,036,876	N13I	probably damaging	Het
Gpr20	C	A	15: 73,695,902	V213L	probably benign	Het
Grk5	T	C	19: 61,076,783	I295T	probably damaging	Het
Gucy1b1	A	G	3: 82,038,042	F430L	probably damaging	Het
Gzmk	T	A	13: 113,173,928	I119L	probably benign	Het
Hadh	T	C	3: 131,245,249	I153V	probably benign	Het
Hsfy2	T	C	1: 56,636,853	Y175C	probably damaging	Het
Hspa5	T	C	2: 34,775,824	I560T	probably benign	Het
Igdcc4	T	C	9: 65,131,663	V863A	probably damaging	Het
Il22ra2	A	G	10: 19,632,872	D216G	probably benign	Het
Klc2	G	A	19: 5,111,654	P303S	probably damaging	Het
Lama5	C	T	2: 180,194,066	V1192I	probably benign	Het
Mon2	A	G	10: 123,026,124	S772P	probably damaging	Het
Mphosph8	T	A	14: 56,672,478	L96Q	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Nckap1	A	G	2: 80,520,585	I726T	probably damaging	Het
Ndnf	A	T	6: 65,703,423	T229S	probably benign	Het
Npas3	A	T	12: 54,048,875		probably null	Het
Nrap	C	T	19: 56,355,529	E729K	probably damaging	Het
Nsun2	T	A	13: 69,627,597	F387I	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Pabpc1l	C	T	2: 164,044,306	T452M	probably benign	Het
Pcdh10	T	C	3: 45,380,015	Y255H	probably damaging	Het
Pdcd6ip	A	T	9: 113,700,019	Y72N	probably damaging	Het
Pglyrp1	A	T	7: 18,884,704		probably benign	Het
Pkp2	T	C	16: 16,268,709		probably null	Het
Ppard	A	G	17: 28,297,180	Y126C	probably damaging	Het
Prkcq	T	C	2: 11,290,533	Y598H	probably damaging	Het
Rhobtb1	A	G	10: 69,270,279	T287A	probably damaging	Het
Sema4b	T	C	7: 80,219,262	Y361H	probably damaging	Het
Slfn9	A	T	11: 82,982,157	I640N	probably damaging	Het
Smurf2	C	A	11: 106,836,070		probably null	Het
Spag5	T	C	11: 78,304,929	V354A	probably benign	Het
Sptb	T	C	12: 76,603,699	D1748G	possibly damaging	Het
St6galnac5	C	A	3: 152,981,250	L22F	probably benign	Het
Sugp2	T	C	8: 70,242,634	S86P	probably damaging	Het
Tnk1	T	C	11: 69,856,473	I111V	possibly damaging	Het
Tnni3k	T	A	3: 154,939,626	I541F	possibly damaging	Het
Trim36	G	T	18: 46,188,657	H108N	possibly damaging	Het
Ttn	T	C	2: 76,870,907		probably benign	Het
Usp28	T	A	9: 49,024,017	S89R	probably benign	Het
Vmn2r121	T	C	X: 124,132,791	D223G	probably benign	Het
Vmn2r65	T	A	7: 84,940,818	Y630F	probably benign	Het
Washc2	T	A	6: 116,256,712	S900T	probably benign	Het
Wdr72	A	G	9: 74,210,199	N731S	probably benign	Het
Xrra1	T	A	7: 99,876,244	F123L	probably damaging	Het
Zfp648	A	G	1: 154,204,242	D49G	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTCTCTCCAAGAACGATATGCAAC -3'
(R):5'- TCTGAGTACCTGCTTAGCCCTAAGAAC -3'

Sequencing Primer
(F):5'- GCAACAGATTAGCATCTTGCTC -3'
(R):5'- CTGCTTAGCCCTAAGAACTTATATAC -3'

Posted On

2014-05-14