Mutagenetix > Incidental Mutations

Incidental Mutation 'R1687:Npas3'

189447

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

MMRRC Submission

039720-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R1687 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to T at 54048875 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]

Predicted Effect

probably null
Transcript: ENSMUST00000101432

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000223057

Predicted Effect

probably null
Transcript: ENSMUST00000223358

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,888	F931I	probably benign	Het
Alox15	T	A	11: 70,349,918	H212L	probably benign	Het
Arhgap42	A	T	9: 9,035,537	V268D	probably benign	Het
Armc9	A	G	1: 86,156,955	M1V	probably null	Het
BB287469	A	G	12: 87,819,718	D133G	unknown	Het
Brca1	C	T	11: 101,489,840	C1789Y	probably benign	Het
Cacng4	A	G	11: 107,736,759	V138A	probably benign	Het
Camsap1	A	G	2: 25,939,615	F699S	probably damaging	Het
Ccm2	A	G	11: 6,585,118	R67G	probably damaging	Het
Cdk16	G	A	X: 20,696,659		probably null	Het
Cep85	T	C	4: 134,148,013	H546R	probably benign	Het
Cfap54	T	C	10: 92,932,640	D207G	probably damaging	Het
Cldn9	G	T	17: 23,683,076	R192S	probably benign	Het
Crybb3	A	G	5: 113,079,767	S63P	probably damaging	Het
Cux1	A	G	5: 136,312,669	L615P	probably damaging	Het
Dctn3	A	G	4: 41,715,407	Y154H	probably damaging	Het
Depdc5	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	5: 32,910,407		probably benign	Het
Dnah3	A	T	7: 120,045,786		probably null	Het
Eml6	G	A	11: 29,833,187	H565Y	probably damaging	Het
Ephb6	T	C	6: 41,617,366	V610A	probably benign	Het
Fam234a	T	C	17: 26,215,308	Y333C	probably damaging	Het
Fbln1	G	A	15: 85,227,106	V154I	probably benign	Het
Frem2	A	T	3: 53,653,952	W1045R	probably benign	Het
Fubp1	A	G	3: 152,228,201		probably benign	Het
Gja3	T	A	14: 57,036,876	N13I	probably damaging	Het
Gpr20	C	A	15: 73,695,902	V213L	probably benign	Het
Grk5	T	C	19: 61,076,783	I295T	probably damaging	Het
Gucy1b1	A	G	3: 82,038,042	F430L	probably damaging	Het
Gzmk	T	A	13: 113,173,928	I119L	probably benign	Het
Hadh	T	C	3: 131,245,249	I153V	probably benign	Het
Hsfy2	T	C	1: 56,636,853	Y175C	probably damaging	Het
Hspa5	T	C	2: 34,775,824	I560T	probably benign	Het
Igdcc4	T	C	9: 65,131,663	V863A	probably damaging	Het
Il22ra2	A	G	10: 19,632,872	D216G	probably benign	Het
Klc2	G	A	19: 5,111,654	P303S	probably damaging	Het
Lama5	C	T	2: 180,194,066	V1192I	probably benign	Het
Mon2	A	G	10: 123,026,124	S772P	probably damaging	Het
Mphosph8	T	A	14: 56,672,478	L96Q	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Nckap1	A	G	2: 80,520,585	I726T	probably damaging	Het
Ndnf	A	T	6: 65,703,423	T229S	probably benign	Het
Nrap	C	T	19: 56,355,529	E729K	probably damaging	Het
Nsun2	T	A	13: 69,627,597	F387I	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Pabpc1l	C	T	2: 164,044,306	T452M	probably benign	Het
Pcdh10	T	C	3: 45,380,015	Y255H	probably damaging	Het
Pdcd6ip	A	T	9: 113,700,019	Y72N	probably damaging	Het
Pglyrp1	A	T	7: 18,884,704		probably benign	Het
Pkp2	T	C	16: 16,268,709		probably null	Het
Ppard	A	G	17: 28,297,180	Y126C	probably damaging	Het
Prkcq	T	C	2: 11,290,533	Y598H	probably damaging	Het
Rhobtb1	A	G	10: 69,270,279	T287A	probably damaging	Het
Sema4b	T	C	7: 80,219,262	Y361H	probably damaging	Het
Slfn9	A	T	11: 82,982,157	I640N	probably damaging	Het
Smurf2	C	A	11: 106,836,070		probably null	Het
Spag5	T	C	11: 78,304,929	V354A	probably benign	Het
Sptb	T	C	12: 76,603,699	D1748G	possibly damaging	Het
St6galnac5	C	A	3: 152,981,250	L22F	probably benign	Het
Sugp2	T	C	8: 70,242,634	S86P	probably damaging	Het
Tnk1	T	C	11: 69,856,473	I111V	possibly damaging	Het
Tnni3k	T	A	3: 154,939,626	I541F	possibly damaging	Het
Trim36	G	T	18: 46,188,657	H108N	possibly damaging	Het
Ttn	T	C	2: 76,870,907		probably benign	Het
Usp28	T	A	9: 49,024,017	S89R	probably benign	Het
Vmn2r121	T	C	X: 124,132,791	D223G	probably benign	Het
Vmn2r65	T	A	7: 84,940,818	Y630F	probably benign	Het
Washc2	T	A	6: 116,256,712	S900T	probably benign	Het
Wdr72	A	G	9: 74,210,199	N731S	probably benign	Het
Xrra1	T	A	7: 99,876,244	F123L	probably damaging	Het
Zfp648	A	G	1: 154,204,242	D49G	probably benign	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3731:Npas3	UTSW	12	53354392	missense	probably benign	0.11
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5302:Npas3	UTSW	12	54068836	missense	probably damaging	1.00
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6987:Npas3	UTSW	12	54068253	missense	possibly damaging	0.94
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACTTGCTCAAAGTGCTGTATCCTCG -3'
(R):5'- AGGCTCTGGCCTATTTGAACTTGTG -3'

Sequencing Primer
(F):5'- TCGAGATCAGCTTCATGCAG -3'
(R):5'- CTACTTGCTGTGAGTGAAAGCAAC -3'

Posted On

2014-05-14