Incidental Mutation 'R1687:Npas3'
ID189447
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 54048875 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect probably null
Transcript: ENSMUST00000101432
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223057
Predicted Effect probably null
Transcript: ENSMUST00000223358
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2004:Npas3 UTSW 12 54067897 missense possibly damaging 0.63
R2047:Npas3 UTSW 12 54068829 missense probably damaging 0.99
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R3767:Npas3 UTSW 12 54069074 makesense probably null
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5524:Npas3 UTSW 12 54068938 missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
R7684:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R7724:Npas3 UTSW 12 54068341 missense possibly damaging 0.90
R7739:Npas3 UTSW 12 54068718 missense probably damaging 1.00
R7826:Npas3 UTSW 12 53831756 missense possibly damaging 0.92
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTGCTCAAAGTGCTGTATCCTCG -3'
(R):5'- AGGCTCTGGCCTATTTGAACTTGTG -3'

Sequencing Primer
(F):5'- TCGAGATCAGCTTCATGCAG -3'
(R):5'- CTACTTGCTGTGAGTGAAAGCAAC -3'
Posted On2014-05-14