Incidental Mutation 'R1687:Mphosph8'
ID 189453
Institutional Source Beutler Lab
Gene Symbol Mphosph8
Ensembl Gene ENSMUSG00000079184
Gene Name M-phase phosphoprotein 8
Synonyms 4930548G07Rik, 1500035L22Rik
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock # R1687 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56668248-56697430 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56672478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 96 (L96Q)
Ref Sequence ENSEMBL: ENSMUSP00000112170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116468]
AlphaFold Q3TYA6
Predicted Effect probably damaging
Transcript: ENSMUST00000116468
AA Change: L96Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112170
Gene: ENSMUSG00000079184
AA Change: L96Q

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
CHROMO 58 111 6.2e-13 SMART
low complexity region 152 160 N/A INTRINSIC
coiled coil region 226 256 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
Blast:ANK 563 592 1e-7 BLAST
ANK 598 627 4.43e-2 SMART
ANK 631 660 5.45e-2 SMART
ANK 664 693 1.08e-5 SMART
Blast:ANK 697 726 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Mphosph8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Mphosph8 APN 14 56674443 missense probably benign 0.00
IGL00786:Mphosph8 APN 14 56672544 missense probably benign 0.00
IGL01635:Mphosph8 APN 14 56672546 missense probably damaging 0.99
IGL02104:Mphosph8 APN 14 56674579 missense probably benign 0.02
IGL02387:Mphosph8 APN 14 56695721 missense probably damaging 1.00
IGL02486:Mphosph8 APN 14 56688387 missense possibly damaging 0.80
IGL02547:Mphosph8 APN 14 56672484 missense probably damaging 1.00
IGL02578:Mphosph8 APN 14 56674210 missense probably benign
IGL03247:Mphosph8 APN 14 56678820 critical splice donor site probably null
IGL03377:Mphosph8 APN 14 56693486 missense probably damaging 1.00
R0412:Mphosph8 UTSW 14 56674413 missense probably damaging 0.97
R0647:Mphosph8 UTSW 14 56674405 missense probably benign
R1079:Mphosph8 UTSW 14 56674259 missense probably damaging 1.00
R1451:Mphosph8 UTSW 14 56668421 missense possibly damaging 0.62
R1486:Mphosph8 UTSW 14 56689039 missense probably damaging 1.00
R1733:Mphosph8 UTSW 14 56693459 missense probably damaging 1.00
R1809:Mphosph8 UTSW 14 56672452 missense probably damaging 1.00
R1844:Mphosph8 UTSW 14 56697159 missense probably damaging 1.00
R2132:Mphosph8 UTSW 14 56678704 missense probably benign 0.04
R4242:Mphosph8 UTSW 14 56674314 missense probably benign 0.00
R4261:Mphosph8 UTSW 14 56674465 missense probably benign 0.00
R4563:Mphosph8 UTSW 14 56691000 missense probably benign 0.00
R4962:Mphosph8 UTSW 14 56678589 missense probably benign 0.27
R5121:Mphosph8 UTSW 14 56676546 nonsense probably null
R6082:Mphosph8 UTSW 14 56668541 missense probably damaging 1.00
R6224:Mphosph8 UTSW 14 56668353 start codon destroyed probably null
R6455:Mphosph8 UTSW 14 56688486 missense probably damaging 1.00
R7086:Mphosph8 UTSW 14 56668523 missense possibly damaging 0.94
R7236:Mphosph8 UTSW 14 56674297 missense possibly damaging 0.63
R7266:Mphosph8 UTSW 14 56685040 missense possibly damaging 0.89
R7564:Mphosph8 UTSW 14 56674038 missense probably benign
R8313:Mphosph8 UTSW 14 56678605 frame shift probably null
R8508:Mphosph8 UTSW 14 56676546 nonsense probably null
R9428:Mphosph8 UTSW 14 56696657 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTCTCTTGCTCCCCACAGC -3'
(R):5'- CTTCCCGTCAGAGGCATCCAGA -3'

Sequencing Primer
(F):5'- CCACAGCTGAATGGGTTTGAA -3'
(R):5'- ACCTGAATATCTTTCCTGACTGC -3'
Posted On 2014-05-14