Incidental Mutation 'R1687:Cldn9'
List |< first << previous [record 13 of 71] next >> last >|
ID189458
Institutional Source Beutler Lab
Gene Symbol Cldn9
Ensembl Gene ENSMUSG00000066720
Gene Nameclaudin 9
Synonymsnmf329
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23682584-23684018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23683076 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 192 (R192S)
Ref Sequence ENSEMBL: ENSMUSP00000093236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024699] [ENSMUST00000085989]
Predicted Effect probably benign
Transcript: ENSMUST00000024699
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085989
AA Change: R192S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720
AA Change: R192S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is developmentally regulated; it is expressed in neonate kidney, but disappers by adulthood. It is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit severe and early hearing loss associated with degeneration of outer hair cells and increased perilymph potassium ion concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Cldn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4195:Cldn9 UTSW 17 23683174 missense probably damaging 1.00
R5710:Cldn9 UTSW 17 23683447 missense probably damaging 1.00
R6676:Cldn9 UTSW 17 23683049 missense probably benign 0.00
R7007:Cldn9 UTSW 17 23683078 missense probably benign
R7336:Cldn9 UTSW 17 23683015 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGAGATCCCCTAAGAGCCAAGTCC -3'
(R):5'- AACAGCATCGTTGTGGCCCAAG -3'

Sequencing Primer
(F):5'- CCAATAAGTGAGCTTCGCAG -3'
(R):5'- AAGTATACGACTCACTGCTGG -3'
Posted On2014-05-14