Incidental Mutation 'R1688:Olfr1102'
ID189476
Institutional Source Beutler Lab
Gene Symbol Olfr1102
Ensembl Gene ENSMUSG00000049843
Gene Nameolfactory receptor 1102
SynonymsMOR179-4, GA_x6K02T2Q125-48487992-48488966
MMRRC Submission 039721-MU
Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86998398-87003618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87002386 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 139 (Y139C)
Ref Sequence ENSEMBL: ENSMUSP00000149634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]
Predicted Effect probably benign
Transcript: ENSMUST00000055129
AA Change: Y139C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: Y139C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7tm_4 43 320 8.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 47 322 8.7e-6 PFAM
Pfam:7tm_1 53 302 3.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214002
AA Change: Y139C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.2065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Olfr1102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1102 APN 2 87002923 missense probably benign 0.31
IGL01584:Olfr1102 APN 2 87002151 missense probably benign 0.04
IGL01913:Olfr1102 APN 2 87002820 missense possibly damaging 0.68
IGL02672:Olfr1102 APN 2 87002073 missense probably benign 0.00
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R1674:Olfr1102 UTSW 2 87002233 missense probably benign 0.07
R3826:Olfr1102 UTSW 2 87002044 missense probably damaging 0.97
R3925:Olfr1102 UTSW 2 87002374 missense possibly damaging 0.91
R4023:Olfr1102 UTSW 2 87002922 nonsense probably null
R4730:Olfr1102 UTSW 2 87002166 missense possibly damaging 0.48
R5154:Olfr1102 UTSW 2 87002038 missense probably benign 0.00
R5525:Olfr1102 UTSW 2 87002339 missense possibly damaging 0.95
R5685:Olfr1102 UTSW 2 87002277 missense probably benign 0.02
R5788:Olfr1102 UTSW 2 87002301 missense probably benign 0.01
R6280:Olfr1102 UTSW 2 87002020 missense probably damaging 0.99
R7178:Olfr1102 UTSW 2 87002535 missense probably benign 0.07
Z1176:Olfr1102 UTSW 2 87002610 missense probably benign 0.04
Z1176:Olfr1102 UTSW 2 87002611 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGAGGATTCACGGCTCCACAAC -3'
(R):5'- TGATGGGATTCAGCATGGGAATCAC -3'

Sequencing Primer
(F):5'- TGTCATCCTTGGATGCCTG -3'
(R):5'- TAGTTCAATGGAGCCTGCAC -3'
Posted On2014-05-14