Incidental Mutation 'R1688:Kcnq2'
ID189477
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Namepotassium voltage-gated channel, subfamily Q, member 2
SynonymsKQT2, Nmf134
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181075579-181135300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181087033 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 540 (V540I)
Ref Sequence ENSEMBL: ENSMUSP00000143263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000129695] [ENSMUST00000149964] [ENSMUST00000197015]
Predicted Effect probably damaging
Transcript: ENSMUST00000016491
AA Change: V540I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346
AA Change: V540I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000049792
AA Change: V540I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346
AA Change: V540I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081528
AA Change: V540I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346
AA Change: V540I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103047
AA Change: V528I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346
AA Change: V528I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103048
AA Change: V540I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346
AA Change: V540I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103049
AA Change: V492I
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: V492I

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103050
AA Change: V537I
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: V537I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103051
AA Change: V550I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: V550I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129073
SMART Domains Protein: ENSMUSP00000127061
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 1e-28 PFAM
Pfam:Ion_trans_2 237 317 3.4e-14 PFAM
Pfam:KCNQ_channel 436 565 3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129695
AA Change: V424I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123488
Gene: ENSMUSG00000016346
AA Change: V424I

DomainStartEndE-ValueType
Pfam:Ion_trans 14 198 6.8e-29 PFAM
Pfam:Ion_trans_2 123 203 2.4e-14 PFAM
Pfam:KCNQ_channel 320 521 1.3e-82 PFAM
low complexity region 559 571 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 621 723 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145861
Predicted Effect probably damaging
Transcript: ENSMUST00000149964
AA Change: V568I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: V568I

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152099
Predicted Effect probably damaging
Transcript: ENSMUST00000197015
AA Change: V540I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: V540I

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197599
AA Change: V246I
Meta Mutation Damage Score 0.7566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 181109789 unclassified probably benign
IGL02064:Kcnq2 APN 2 181109026 missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 181081715 missense probably benign 0.22
IGL02261:Kcnq2 APN 2 181081690 missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 181081361 missense probably benign
IGL02583:Kcnq2 APN 2 181081502 missense probably benign 0.01
IGL02627:Kcnq2 APN 2 181082327 unclassified probably benign
IGL03303:Kcnq2 APN 2 181082389 missense probably benign
R0269:Kcnq2 UTSW 2 181096974 missense probably benign 0.00
R1535:Kcnq2 UTSW 2 181134825 missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 181100557 missense probably benign 0.01
R1946:Kcnq2 UTSW 2 181088451 missense probably benign 0.09
R2105:Kcnq2 UTSW 2 181081352 missense probably benign 0.03
R2382:Kcnq2 UTSW 2 181112107 missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 181081774 missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 181104900 missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 181109686 missense probably damaging 0.97
R4282:Kcnq2 UTSW 2 181081153 missense probably damaging 1.00
R4938:Kcnq2 UTSW 2 181086973 missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 181112043 missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 181086761 intron probably benign
R5107:Kcnq2 UTSW 2 181108547 intron probably benign
R5371:Kcnq2 UTSW 2 181135020 missense probably damaging 1.00
R5557:Kcnq2 UTSW 2 181134897 missense probably benign 0.07
R5839:Kcnq2 UTSW 2 181109751 missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 181087008 missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 181087656 missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 181113233 missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 181085306 missense possibly damaging 0.94
R7018:Kcnq2 UTSW 2 181081724 nonsense probably null
R7266:Kcnq2 UTSW 2 181135092 start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 181088379 missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 181109102 missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 181113094 missense probably damaging 0.97
R7573:Kcnq2 UTSW 2 181081589 missense probably benign 0.04
R7897:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
R7980:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACATAGACTTGCTACCACAGTG -3'
(R):5'- ACAACTGTCCCGTACCAGTGGTTC -3'

Sequencing Primer
(F):5'- CTACCACAGTGTGGGTGAG -3'
(R):5'- CCAGTTGAGGATGGATACTATTTCCC -3'
Posted On2014-05-14