Incidental Mutation 'R1688:Crybg1'
ID189504
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43973798 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1660 (F1660L)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020017
AA Change: F1286L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: F1286L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200401
AA Change: F1660L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: F1660L

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.2751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTGAGGGCTGACTCTGCATCAC -3'
(R):5'- GGGAAGCATTGCGAATGTCTGACTG -3'

Sequencing Primer
(F):5'- CTACTAATTTAACAGAAACCCGAGTG -3'
(R):5'- CCACCAGTATTTGCTGGAGGAG -3'
Posted On2014-05-14