Incidental Mutation 'R1688:Serpina3a'
ID189515
Institutional Source Beutler Lab
Gene Symbol Serpina3a
Ensembl Gene ENSMUSG00000041536
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104112724-104121896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104118643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 99 (D99V)
Ref Sequence ENSEMBL: ENSMUSP00000105591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021496] [ENSMUST00000109965] [ENSMUST00000185595]
Predicted Effect probably benign
Transcript: ENSMUST00000021496
AA Change: D289V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021496
Gene: ENSMUSG00000041536
AA Change: D289V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109965
AA Change: D99V

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105591
Gene: ENSMUSG00000041536
AA Change: D99V

DomainStartEndE-ValueType
SERPIN 4 229 5.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185595
AA Change: D289V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140024
Gene: ENSMUSG00000041536
AA Change: D289V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Serpina3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Serpina3a APN 12 104121499 missense probably benign 0.05
IGL02003:Serpina3a APN 12 104116000 missense probably benign 0.02
IGL02379:Serpina3a APN 12 104118660 missense probably benign 0.00
IGL02547:Serpina3a APN 12 104116543 missense probably damaging 0.98
IGL02593:Serpina3a APN 12 104118432 missense probably benign 0.01
IGL02730:Serpina3a APN 12 104119663 missense probably damaging 1.00
IGL02953:Serpina3a APN 12 104116489 missense probably benign 0.00
IGL03197:Serpina3a APN 12 104116241 missense probably damaging 1.00
R1184:Serpina3a UTSW 12 104116528 nonsense probably null
R1635:Serpina3a UTSW 12 104116478 missense probably damaging 1.00
R1804:Serpina3a UTSW 12 104118416 splice site probably benign
R1867:Serpina3a UTSW 12 104118627 missense probably benign 0.01
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R2110:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2111:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2305:Serpina3a UTSW 12 104116528 missense probably benign 0.05
R2326:Serpina3a UTSW 12 104116499 missense probably benign 0.01
R2405:Serpina3a UTSW 12 104121318 missense possibly damaging 0.50
R4008:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4010:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4011:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4079:Serpina3a UTSW 12 104119675 nonsense probably null
R4091:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4092:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4210:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R5064:Serpina3a UTSW 12 104116189 missense probably benign 0.01
R6242:Serpina3a UTSW 12 104116001 missense probably benign 0.10
R6337:Serpina3a UTSW 12 104112878 missense probably benign 0.36
R6395:Serpina3a UTSW 12 104116451 missense probably damaging 0.99
R6683:Serpina3a UTSW 12 104119637 missense probably benign 0.16
R6994:Serpina3a UTSW 12 104112830 utr 5 prime probably null
R7117:Serpina3a UTSW 12 104116177 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTTTGACCCTGAAGACACGTTCC -3'
(R):5'- AGAGTAAACGCAGGTGCCCAATC -3'

Sequencing Primer
(F):5'- TGTGCCCATGATGAAAACCG -3'
(R):5'- AGGTGCCCAATCAACTGG -3'
Posted On2014-05-14