Incidental Mutation 'R1688:Bin1'
ID189535
Institutional Source Beutler Lab
Gene Symbol Bin1
Ensembl Gene ENSMUSG00000024381
Gene Namebridging integrator 1
SynonymsAmphl, Amphiphysin 2
MMRRC Submission 039721-MU
Accession Numbers

Genbank: NM_009668, NM_001083334; MGI: 108092

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32377217-32435736 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 32419935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025239] [ENSMUST00000091967]
Predicted Effect probably benign
Transcript: ENSMUST00000025239
SMART Domains Protein: ENSMUSP00000025239
Gene: ENSMUSG00000024381

DomainStartEndE-ValueType
BAR 17 269 3.04e-81 SMART
low complexity region 296 305 N/A INTRINSIC
PDB:1MV3|A 306 378 3e-31 PDB
Blast:BAR 395 506 4e-48 BLAST
SH3 518 588 5.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091967
SMART Domains Protein: ENSMUSP00000089590
Gene: ENSMUSG00000024381

DomainStartEndE-ValueType
BAR 17 238 3.92e-84 SMART
low complexity region 265 274 N/A INTRINSIC
low complexity region 309 315 N/A INTRINSIC
Blast:BAR 319 395 2e-8 BLAST
SH3 407 477 5.4e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutation of this gene results in thickened ventricular walls, densely packed myocardiocytes, and disorganization of myofibrils. Mutant animals die shortly after birth. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Bin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Bin1 APN 18 32420107 missense probably damaging 1.00
IGL00972:Bin1 APN 18 32424834 missense probably benign 0.01
IGL01551:Bin1 APN 18 32377458 missense probably benign 0.44
IGL01609:Bin1 APN 18 32419925 missense probably damaging 1.00
R1370:Bin1 UTSW 18 32429703 missense probably benign 0.05
R1496:Bin1 UTSW 18 32412704 missense probably damaging 0.99
R1688:Bin1 UTSW 18 32424972 splice site probably benign
R2483:Bin1 UTSW 18 32414227 missense probably damaging 1.00
R3941:Bin1 UTSW 18 32406158 missense probably damaging 1.00
R5026:Bin1 UTSW 18 32419930 critical splice donor site probably null
R5768:Bin1 UTSW 18 32426211 splice site probably null
R6770:Bin1 UTSW 18 32406149 missense probably damaging 1.00
R6906:Bin1 UTSW 18 32421925 missense probably benign 0.00
R7239:Bin1 UTSW 18 32406171 missense probably damaging 1.00
R7593:Bin1 UTSW 18 32419879 nonsense probably null
X0011:Bin1 UTSW 18 32426279 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTAATGGCAGCTCAACCTTCCC -3'
(R):5'- AAGTTTTCCTCCAGACCCGCGATG -3'

Sequencing Primer
(F):5'- GGCTCCAATGGGAAGTTCTG -3'
(R):5'- GCGATGCTCTGGAACGTG -3'
Posted On2014-05-14