Incidental Mutation 'R1689:Sned1'
ID189542
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93283372 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1061 (R1061C)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect probably damaging
Transcript: ENSMUST00000062202
AA Change: R1061C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: R1061C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163688
AA Change: R270C
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: R270C

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
R7899:Sned1 UTSW 1 93274082 missense probably benign 0.04
R8093:Sned1 UTSW 1 93274665 missense possibly damaging 0.82
R8124:Sned1 UTSW 1 93282989 critical splice donor site probably null
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Z1176:Sned1 UTSW 1 93259042 missense probably damaging 1.00
Z1177:Sned1 UTSW 1 93285820 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGACCCTGTTTAGCAGACAGCTC -3'
(R):5'- GTTAGCCGCACAGTGTATCTTCTCC -3'

Sequencing Primer
(F):5'- TTTCCTACAGGGAAGGATGC -3'
(R):5'- AGGTCCCTGTCAGAAGTGG -3'
Posted On2014-05-14