Incidental Mutation 'R1689:Igsf8'
ID189545
Institutional Source Beutler Lab
Gene Symbol Igsf8
Ensembl Gene ENSMUSG00000038034
Gene Nameimmunoglobulin superfamily, member 8
SynonymsPGRL, KCT-4, ESTM34, EWI-2, PG regulatory-like protein
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172261641-172319841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 172318937 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 564 (G564W)
Ref Sequence ENSEMBL: ENSMUSP00000083076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000128508] [ENSMUST00000139528] [ENSMUST00000194204] [ENSMUST00000195659]
Predicted Effect probably damaging
Transcript: ENSMUST00000039506
AA Change: G564W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034
AA Change: G564W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062387
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085912
AA Change: G564W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034
AA Change: G564W

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128508
SMART Domains Protein: ENSMUSP00000122611
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139528
AA Change: G501W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034
AA Change: G501W

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192957
Predicted Effect probably benign
Transcript: ENSMUST00000194204
SMART Domains Protein: ENSMUSP00000141633
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 361 7.4e-165 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194505
AA Change: G173W
Predicted Effect probably damaging
Transcript: ENSMUST00000195659
AA Change: G60W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034
AA Change: G60W

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Igsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igsf8 APN 1 172317544 missense possibly damaging 0.48
IGL02090:Igsf8 APN 1 172312589 intron probably benign
IGL02523:Igsf8 APN 1 172319413 utr 3 prime probably benign
IGL03092:Igsf8 APN 1 172312529 intron probably benign
IGL03184:Igsf8 APN 1 172318632 missense probably damaging 0.96
R0398:Igsf8 UTSW 1 172317499 missense probably damaging 1.00
R0468:Igsf8 UTSW 1 172318796 missense probably damaging 1.00
R0494:Igsf8 UTSW 1 172318698 missense probably benign 0.06
R0612:Igsf8 UTSW 1 172319407 makesense probably null
R0613:Igsf8 UTSW 1 172317589 missense probably benign 0.00
R0883:Igsf8 UTSW 1 172316259 missense possibly damaging 0.67
R0941:Igsf8 UTSW 1 172316396 missense probably damaging 1.00
R1706:Igsf8 UTSW 1 172317405 missense probably damaging 1.00
R2050:Igsf8 UTSW 1 172318865 missense probably damaging 1.00
R2182:Igsf8 UTSW 1 172290728 critical splice donor site probably null
R3625:Igsf8 UTSW 1 172317769 missense probably benign 0.18
R3833:Igsf8 UTSW 1 172318270 missense probably benign 0.00
R4674:Igsf8 UTSW 1 172318912 nonsense probably null
R4796:Igsf8 UTSW 1 172316322 missense probably benign 0.07
R6768:Igsf8 UTSW 1 172317532 missense probably damaging 1.00
R7519:Igsf8 UTSW 1 172316307 missense probably benign 0.38
Z1176:Igsf8 UTSW 1 172318354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTCCCTGCTATGCAACATATC -3'
(R):5'- AGTACCACGGTCTCTGACACTCTC -3'

Sequencing Primer
(F):5'- TGCTATGCAACATATCTGTGC -3'
(R):5'- tccacccccaccaccac -3'
Posted On2014-05-14